Mutagenetix > Incidental Mutation

Incidental Mutation 'R5558:Lca5'

436413

Institutional Source

Beutler Lab

Gene Symbol

Lca5

Ensembl Gene

ENSMUSG00000032258

Gene Name

Leber congenital amaurosis 5 (human)

Synonyms

4930431B11Rik, 5730406O13Rik, ORF64

MMRRC Submission

043115-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.552) question?

Stock #

R5558 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83390293-83441127 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 83401743 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 246 (S246T)

Ref Sequence

ENSEMBL: ENSMUSP00000034791 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034791] [ENSMUST00000034793] [ENSMUST00000190514]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000034791
AA Change: S246T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000034791
Gene: ENSMUSG00000032258
AA Change: S246T

Domain	Start	End	E-Value	Type
low complexity region	25	40	N/A	INTRINSIC
Pfam:Lebercilin	103	295	2.6e-66	PFAM
low complexity region	306	315	N/A	INTRINSIC
low complexity region	617	627	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034793
AA Change: S246T

PolyPhen 2 Score 0.477 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000034793
Gene: ENSMUSG00000032258
AA Change: S246T

Domain	Start	End	E-Value	Type
low complexity region	25	40	N/A	INTRINSIC
Pfam:Lebercilin	102	295	4.8e-71	PFAM
low complexity region	306	315	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190514
AA Change: S246T

PolyPhen 2 Score 0.477 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000140753
Gene: ENSMUSG00000032258
AA Change: S246T

Domain	Start	End	E-Value	Type
low complexity region	25	40	N/A	INTRINSIC
Pfam:Lebercilin	102	295	5.8e-71	PFAM
low complexity region	306	315	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191225

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is thought to be involved in centrosomal or ciliary functions. Mutations in this gene cause Leber congenital amaurosis type V. Alternatively spliced transcript variants are described. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit retinal patches of depigmentation, lack rod and cone ERG responses to light stimuli, and show loss of ciliary intraflagellar transport function in photoreceptors leading to failure of outer segment formation and photoreceptor degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810403A07Rik	A	C	3: 88,693,096	H164P	probably damaging	Het
Abcg4	T	C	9: 44,281,408	K177E	probably damaging	Het
Acvr1	T	C	2: 58,459,017	T378A	probably damaging	Het
Agtpbp1	A	G	13: 59,482,580	V779A	probably benign	Het
Alms1	C	T	6: 85,641,329	Q2786*	probably null	Het
Arhgef28	A	C	13: 97,961,460	L882R	probably damaging	Het
Cbx2	A	G	11: 119,028,949	T447A	probably benign	Het
Ch25h	A	G	19: 34,474,463	W222R	probably damaging	Het
Chsy3	T	G	18: 59,176,397	S241A	probably damaging	Het
Cyfip1	T	C	7: 55,892,001	S345P	possibly damaging	Het
Cyp4a30b	C	A	4: 115,458,866	D291E	probably damaging	Het
Dcstamp	A	G	15: 39,759,540	Y419C	probably damaging	Het
Eif3d	G	A	15: 77,961,847	R359C	probably damaging	Het
Elavl4	C	A	4: 110,206,603	G267V	probably benign	Het
Gars	T	C	6: 55,065,607	S442P	probably damaging	Het
Gas6	C	T	8: 13,466,764	R578Q	probably null	Het
Hist1h4d	C	A	13: 23,581,796	N65K	possibly damaging	Het
Ifitm6	T	C	7: 141,016,072	I103V	probably benign	Het
Igsf5	T	A	16: 96,386,531	I241N	possibly damaging	Het
Iqce	A	G	5: 140,671,805		probably null	Het
Kif20b	C	A	19: 34,951,549	Q1192K	probably damaging	Het
Lap3	A	G	5: 45,504,751	N298D	probably benign	Het
Mrps5	G	A	2: 127,602,435	G330S	probably damaging	Het
Myh15	C	T	16: 49,069,537	R164C	probably benign	Het
Myo19	C	G	11: 84,910,448	P940R	probably damaging	Het
Olfr1406	T	C	1: 173,184,018	R139G	probably benign	Het
Olfr1445	T	C	19: 12,884,387	F169L	probably benign	Het
Pcdh10	A	G	3: 45,384,168	D920G	probably damaging	Het
Pgm5	A	T	19: 24,824,451		probably null	Het
Phactr4	T	C	4: 132,378,455	E137G	probably damaging	Het
Pkn1	C	T	8: 83,684,722	V239M	probably damaging	Het
Plcz1	T	A	6: 140,039,755	D20V	probably damaging	Het
Prkca	A	T	11: 107,981,647	I429N	probably damaging	Het
Ptk2	A	T	15: 73,304,445	Y251N	probably damaging	Het
R3hdm2	T	C	10: 127,444,402	F31S	probably damaging	Het
Rab11fip1	T	A	8: 27,151,975	E932V	probably damaging	Het
Rilp	A	G	11: 75,511,425	Y250C	probably damaging	Het
Sclt1	A	G	3: 41,661,590	I474T	probably benign	Het
Slc14a2	T	A	18: 78,159,166	D583V	possibly damaging	Het
Slc30a4	A	G	2: 122,686,983	I324T	probably damaging	Het
Slc6a5	G	A	7: 49,927,573	V326I	probably benign	Het
Slco1c1	C	T	6: 141,567,496	T617I	probably damaging	Het
Sntg1	A	G	1: 8,414,271	S442P	possibly damaging	Het
Sys1	G	T	2: 164,464,509	A128S	possibly damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Tmed5	A	G	5: 108,124,596	I212T	probably benign	Het
Tnks	T	C	8: 34,965,665	M1V	probably null	Het
Trpa1	T	C	1: 14,898,268	H452R	probably damaging	Het
Trpm3	T	C	19: 22,978,573	V1133A	probably damaging	Het
Ttn	T	A	2: 76,725,051	I30537F	probably damaging	Het
Ush2a	T	C	1: 188,797,827	V3271A	possibly damaging	Het
Utp20	C	G	10: 88,751,467	G2489R	probably damaging	Het
Vmn1r70	A	T	7: 10,634,475	S278C	probably benign	Het
Wdpcp	G	A	11: 21,711,732	A335T	probably benign	Het
Zc3h18	G	T	8: 122,386,920	R217L	probably damaging	Het
Zfp384	ACAGCAGCAGCAGCAGCAGCAGC	ACAGCAGCAGCAGCAGCAGC	6: 125,036,509		probably benign	Het
Zfp955b	C	T	17: 33,302,187	T210I	possibly damaging	Het

Other mutations in Lca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01073:Lca5	APN	9	83395475	missense	probably damaging	0.98
IGL01349:Lca5	APN	9	83426617	missense	probably damaging	1.00
IGL01918:Lca5	APN	9	83423148	missense	probably damaging	1.00
IGL02035:Lca5	APN	9	83423312	missense	probably damaging	1.00
IGL02276:Lca5	APN	9	83398585	missense	possibly damaging	0.79
IGL02425:Lca5	APN	9	83399721	missense	probably damaging	1.00
IGL02481:Lca5	APN	9	83423117	missense	probably damaging	1.00
IGL02483:Lca5	APN	9	83423117	missense	probably damaging	1.00
R0465:Lca5	UTSW	9	83395867	nonsense	probably null
R0610:Lca5	UTSW	9	83399739	missense	probably benign	0.24
R0811:Lca5	UTSW	9	83399753	missense	possibly damaging	0.95
R0812:Lca5	UTSW	9	83399753	missense	possibly damaging	0.95
R0968:Lca5	UTSW	9	83423169	missense	probably benign	0.01
R1891:Lca5	UTSW	9	83395608	missense	probably damaging	1.00
R5223:Lca5	UTSW	9	83398613	missense	probably benign	0.00
R5235:Lca5	UTSW	9	83423054	nonsense	probably null
R5260:Lca5	UTSW	9	83423223	missense	probably damaging	0.98
R5531:Lca5	UTSW	9	83398595	missense	probably benign	0.00
R5688:Lca5	UTSW	9	83398566	missense	probably benign	0.01
R5886:Lca5	UTSW	9	83399681	missense	probably benign	0.31
R6426:Lca5	UTSW	9	83395654	nonsense	probably null
R7108:Lca5	UTSW	9	83423169	missense	probably benign	0.25
R7151:Lca5	UTSW	9	83398640	missense	probably benign	0.20
R7314:Lca5	UTSW	9	83395510	missense	possibly damaging	0.86
R7378:Lca5	UTSW	9	83395530	missense	probably benign	0.00
R7468:Lca5	UTSW	9	83423456	missense	probably damaging	0.99
R7686:Lca5	UTSW	9	83395239	missense	probably benign	0.00
R8874:Lca5	UTSW	9	83395450	missense	probably damaging	1.00
R8934:Lca5	UTSW	9	83391856	utr 3 prime	probably benign
R8987:Lca5	UTSW	9	83401743	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTTAGATGGCGTGAGAAATC -3'
(R):5'- GGTGTGTAAGGACTGATTACCC -3'

Sequencing Primer
(F):5'- TGAGAAATCATGCCGCCGTC -3'
(R):5'- GTGTAAGGACTGATTACCCATCATC -3'

Posted On

2016-10-24