Incidental Mutation 'R5558:Lca5'
ID436413
Institutional Source Beutler Lab
Gene Symbol Lca5
Ensembl Gene ENSMUSG00000032258
Gene NameLeber congenital amaurosis 5 (human)
Synonyms4930431B11Rik, 5730406O13Rik, ORF64
MMRRC Submission 043115-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.660) question?
Stock #R5558 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location83390293-83441127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83401743 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 246 (S246T)
Ref Sequence ENSEMBL: ENSMUSP00000034791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034791] [ENSMUST00000034793] [ENSMUST00000190514]
Predicted Effect probably damaging
Transcript: ENSMUST00000034791
AA Change: S246T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034791
Gene: ENSMUSG00000032258
AA Change: S246T

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:Lebercilin 103 295 2.6e-66 PFAM
low complexity region 306 315 N/A INTRINSIC
low complexity region 617 627 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000034793
AA Change: S246T

PolyPhen 2 Score 0.477 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034793
Gene: ENSMUSG00000032258
AA Change: S246T

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:Lebercilin 102 295 4.8e-71 PFAM
low complexity region 306 315 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190514
AA Change: S246T

PolyPhen 2 Score 0.477 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140753
Gene: ENSMUSG00000032258
AA Change: S246T

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:Lebercilin 102 295 5.8e-71 PFAM
low complexity region 306 315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191225
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is thought to be involved in centrosomal or ciliary functions. Mutations in this gene cause Leber congenital amaurosis type V. Alternatively spliced transcript variants are described. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit retinal patches of depigmentation, lack rod and cone ERG responses to light stimuli, and show loss of ciliary intraflagellar transport function in photoreceptors leading to failure of outer segment formation and photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A C 3: 88,693,096 H164P probably damaging Het
Abcg4 T C 9: 44,281,408 K177E probably damaging Het
Acvr1 T C 2: 58,459,017 T378A probably damaging Het
Agtpbp1 A G 13: 59,482,580 V779A probably benign Het
Alms1 C T 6: 85,641,329 Q2786* probably null Het
Arhgef28 A C 13: 97,961,460 L882R probably damaging Het
Cbx2 A G 11: 119,028,949 T447A probably benign Het
Ch25h A G 19: 34,474,463 W222R probably damaging Het
Chsy3 T G 18: 59,176,397 S241A probably damaging Het
Cyfip1 T C 7: 55,892,001 S345P possibly damaging Het
Cyp4a30b C A 4: 115,458,866 D291E probably damaging Het
Dcstamp A G 15: 39,759,540 Y419C probably damaging Het
Eif3d G A 15: 77,961,847 R359C probably damaging Het
Elavl4 C A 4: 110,206,603 G267V probably benign Het
Gars T C 6: 55,065,607 S442P probably damaging Het
Gas6 C T 8: 13,466,764 R578Q probably null Het
Hist1h4d C A 13: 23,581,796 N65K possibly damaging Het
Ifitm6 T C 7: 141,016,072 I103V probably benign Het
Igsf5 T A 16: 96,386,531 I241N possibly damaging Het
Iqce A G 5: 140,671,805 probably null Het
Kif20b C A 19: 34,951,549 Q1192K probably damaging Het
Lap3 A G 5: 45,504,751 N298D probably benign Het
Mrps5 G A 2: 127,602,435 G330S probably damaging Het
Myh15 C T 16: 49,069,537 R164C probably benign Het
Myo19 C G 11: 84,910,448 P940R probably damaging Het
Olfr1406 T C 1: 173,184,018 R139G probably benign Het
Olfr1445 T C 19: 12,884,387 F169L probably benign Het
Pcdh10 A G 3: 45,384,168 D920G probably damaging Het
Pgm5 A T 19: 24,824,451 probably null Het
Phactr4 T C 4: 132,378,455 E137G probably damaging Het
Pkn1 C T 8: 83,684,722 V239M probably damaging Het
Plcz1 T A 6: 140,039,755 D20V probably damaging Het
Prkca A T 11: 107,981,647 I429N probably damaging Het
Ptk2 A T 15: 73,304,445 Y251N probably damaging Het
R3hdm2 T C 10: 127,444,402 F31S probably damaging Het
Rab11fip1 T A 8: 27,151,975 E932V probably damaging Het
Rilp A G 11: 75,511,425 Y250C probably damaging Het
Sclt1 A G 3: 41,661,590 I474T probably benign Het
Slc14a2 T A 18: 78,159,166 D583V possibly damaging Het
Slc30a4 A G 2: 122,686,983 I324T probably damaging Het
Slc6a5 G A 7: 49,927,573 V326I probably benign Het
Slco1c1 C T 6: 141,567,496 T617I probably damaging Het
Sntg1 A G 1: 8,414,271 S442P possibly damaging Het
Sys1 G T 2: 164,464,509 A128S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmed5 A G 5: 108,124,596 I212T probably benign Het
Tnks T C 8: 34,965,665 M1V probably null Het
Trpa1 T C 1: 14,898,268 H452R probably damaging Het
Trpm3 T C 19: 22,978,573 V1133A probably damaging Het
Ttn T A 2: 76,725,051 I30537F probably damaging Het
Ush2a T C 1: 188,797,827 V3271A possibly damaging Het
Utp20 C G 10: 88,751,467 G2489R probably damaging Het
Vmn1r70 A T 7: 10,634,475 S278C probably benign Het
Wdpcp G A 11: 21,711,732 A335T probably benign Het
Zc3h18 G T 8: 122,386,920 R217L probably damaging Het
Zfp384 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 6: 125,036,509 probably benign Het
Zfp955b C T 17: 33,302,187 T210I possibly damaging Het
Other mutations in Lca5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Lca5 APN 9 83395475 missense probably damaging 0.98
IGL01349:Lca5 APN 9 83426617 missense probably damaging 1.00
IGL01918:Lca5 APN 9 83423148 missense probably damaging 1.00
IGL02035:Lca5 APN 9 83423312 missense probably damaging 1.00
IGL02276:Lca5 APN 9 83398585 missense possibly damaging 0.79
IGL02425:Lca5 APN 9 83399721 missense probably damaging 1.00
IGL02481:Lca5 APN 9 83423117 missense probably damaging 1.00
IGL02483:Lca5 APN 9 83423117 missense probably damaging 1.00
R0465:Lca5 UTSW 9 83395867 nonsense probably null
R0610:Lca5 UTSW 9 83399739 missense probably benign 0.24
R0811:Lca5 UTSW 9 83399753 missense possibly damaging 0.95
R0812:Lca5 UTSW 9 83399753 missense possibly damaging 0.95
R0968:Lca5 UTSW 9 83423169 missense probably benign 0.01
R1891:Lca5 UTSW 9 83395608 missense probably damaging 1.00
R5223:Lca5 UTSW 9 83398613 missense probably benign 0.00
R5235:Lca5 UTSW 9 83423054 nonsense probably null
R5260:Lca5 UTSW 9 83423223 missense probably damaging 0.98
R5531:Lca5 UTSW 9 83398595 missense probably benign 0.00
R5688:Lca5 UTSW 9 83398566 missense probably benign 0.01
R5886:Lca5 UTSW 9 83399681 missense probably benign 0.31
R6426:Lca5 UTSW 9 83395654 nonsense probably null
R7108:Lca5 UTSW 9 83423169 missense probably benign 0.25
R7151:Lca5 UTSW 9 83398640 missense probably benign 0.20
R7314:Lca5 UTSW 9 83395510 missense possibly damaging 0.86
R7378:Lca5 UTSW 9 83395530 missense probably benign 0.00
R7468:Lca5 UTSW 9 83423456 missense probably damaging 0.99
R7686:Lca5 UTSW 9 83395239 missense probably benign 0.00
R8874:Lca5 UTSW 9 83395450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTTAGATGGCGTGAGAAATC -3'
(R):5'- GGTGTGTAAGGACTGATTACCC -3'

Sequencing Primer
(F):5'- TGAGAAATCATGCCGCCGTC -3'
(R):5'- GTGTAAGGACTGATTACCCATCATC -3'
Posted On2016-10-24