Incidental Mutation 'R5558:Myo19'
ID436419
Institutional Source Beutler Lab
Gene Symbol Myo19
Ensembl Gene ENSMUSG00000020527
Gene Namemyosin XIX
SynonymsMyohd1, 1110055A02Rik
MMRRC Submission 043115-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R5558 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location84880148-84911226 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 84910448 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 940 (P940R)
Ref Sequence ENSEMBL: ENSMUSP00000091502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093969] [ENSMUST00000103195]
Predicted Effect probably damaging
Transcript: ENSMUST00000093969
AA Change: P940R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091502
Gene: ENSMUSG00000020527
AA Change: P940R

DomainStartEndE-ValueType
MYSc 29 759 4.07e-219 SMART
IQ 760 782 1.74e1 SMART
IQ 783 804 1.97e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103195
SMART Domains Protein: ENSMUSP00000099484
Gene: ENSMUSG00000020526

DomainStartEndE-ValueType
Pfam:zf-HIT 7 36 9.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141705
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156046
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A C 3: 88,693,096 H164P probably damaging Het
Abcg4 T C 9: 44,281,408 K177E probably damaging Het
Acvr1 T C 2: 58,459,017 T378A probably damaging Het
Agtpbp1 A G 13: 59,482,580 V779A probably benign Het
Alms1 C T 6: 85,641,329 Q2786* probably null Het
Arhgef28 A C 13: 97,961,460 L882R probably damaging Het
Cbx2 A G 11: 119,028,949 T447A probably benign Het
Ch25h A G 19: 34,474,463 W222R probably damaging Het
Chsy3 T G 18: 59,176,397 S241A probably damaging Het
Cyfip1 T C 7: 55,892,001 S345P possibly damaging Het
Cyp4a30b C A 4: 115,458,866 D291E probably damaging Het
Dcstamp A G 15: 39,759,540 Y419C probably damaging Het
Eif3d G A 15: 77,961,847 R359C probably damaging Het
Elavl4 C A 4: 110,206,603 G267V probably benign Het
Gars T C 6: 55,065,607 S442P probably damaging Het
Gas6 C T 8: 13,466,764 R578Q probably null Het
Hist1h4d C A 13: 23,581,796 N65K possibly damaging Het
Ifitm6 T C 7: 141,016,072 I103V probably benign Het
Igsf5 T A 16: 96,386,531 I241N possibly damaging Het
Iqce A G 5: 140,671,805 probably null Het
Kif20b C A 19: 34,951,549 Q1192K probably damaging Het
Lap3 A G 5: 45,504,751 N298D probably benign Het
Lca5 A T 9: 83,401,743 S246T probably damaging Het
Mrps5 G A 2: 127,602,435 G330S probably damaging Het
Myh15 C T 16: 49,069,537 R164C probably benign Het
Olfr1406 T C 1: 173,184,018 R139G probably benign Het
Olfr1445 T C 19: 12,884,387 F169L probably benign Het
Pcdh10 A G 3: 45,384,168 D920G probably damaging Het
Pgm5 A T 19: 24,824,451 probably null Het
Phactr4 T C 4: 132,378,455 E137G probably damaging Het
Pkn1 C T 8: 83,684,722 V239M probably damaging Het
Plcz1 T A 6: 140,039,755 D20V probably damaging Het
Prkca A T 11: 107,981,647 I429N probably damaging Het
Ptk2 A T 15: 73,304,445 Y251N probably damaging Het
R3hdm2 T C 10: 127,444,402 F31S probably damaging Het
Rab11fip1 T A 8: 27,151,975 E932V probably damaging Het
Rilp A G 11: 75,511,425 Y250C probably damaging Het
Sclt1 A G 3: 41,661,590 I474T probably benign Het
Slc14a2 T A 18: 78,159,166 D583V possibly damaging Het
Slc30a4 A G 2: 122,686,983 I324T probably damaging Het
Slc6a5 G A 7: 49,927,573 V326I probably benign Het
Slco1c1 C T 6: 141,567,496 T617I probably damaging Het
Sntg1 A G 1: 8,414,271 S442P possibly damaging Het
Sys1 G T 2: 164,464,509 A128S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmed5 A G 5: 108,124,596 I212T probably benign Het
Tnks T C 8: 34,965,665 M1V probably null Het
Trpa1 T C 1: 14,898,268 H452R probably damaging Het
Trpm3 T C 19: 22,978,573 V1133A probably damaging Het
Ttn T A 2: 76,725,051 I30537F probably damaging Het
Ush2a T C 1: 188,797,827 V3271A possibly damaging Het
Utp20 C G 10: 88,751,467 G2489R probably damaging Het
Vmn1r70 A T 7: 10,634,475 S278C probably benign Het
Wdpcp G A 11: 21,711,732 A335T probably benign Het
Zc3h18 G T 8: 122,386,920 R217L probably damaging Het
Zfp384 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 6: 125,036,509 probably benign Het
Zfp955b C T 17: 33,302,187 T210I possibly damaging Het
Other mutations in Myo19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Myo19 APN 11 84909498 missense probably benign 0.00
IGL01120:Myo19 APN 11 84907278 missense probably damaging 0.96
IGL01542:Myo19 APN 11 84909546 missense probably damaging 0.96
IGL02341:Myo19 APN 11 84888045 splice site probably benign
IGL02708:Myo19 APN 11 84899396 missense possibly damaging 0.89
IGL03223:Myo19 APN 11 84910471 missense possibly damaging 0.57
BB004:Myo19 UTSW 11 84900220 missense probably damaging 1.00
BB014:Myo19 UTSW 11 84900220 missense probably damaging 1.00
R0009:Myo19 UTSW 11 84888169 critical splice donor site probably null
R0125:Myo19 UTSW 11 84888175 splice site probably benign
R0142:Myo19 UTSW 11 84894603 missense probably damaging 1.00
R0226:Myo19 UTSW 11 84897732 splice site probably benign
R0230:Myo19 UTSW 11 84893333 missense possibly damaging 0.91
R0482:Myo19 UTSW 11 84909419 missense probably benign 0.00
R1981:Myo19 UTSW 11 84892170 missense possibly damaging 0.46
R2035:Myo19 UTSW 11 84897608 missense probably benign
R2185:Myo19 UTSW 11 84892221 missense probably benign 0.00
R3176:Myo19 UTSW 11 84892175 missense probably benign 0.01
R3276:Myo19 UTSW 11 84892175 missense probably benign 0.01
R3824:Myo19 UTSW 11 84885679 missense probably damaging 0.98
R3914:Myo19 UTSW 11 84894603 missense probably damaging 1.00
R4333:Myo19 UTSW 11 84908288 missense probably benign 0.00
R4335:Myo19 UTSW 11 84908288 missense probably benign 0.00
R4647:Myo19 UTSW 11 84894642 missense probably damaging 1.00
R4968:Myo19 UTSW 11 84901502 missense probably damaging 1.00
R4971:Myo19 UTSW 11 84892197 missense probably damaging 1.00
R5083:Myo19 UTSW 11 84903211 missense possibly damaging 0.60
R5284:Myo19 UTSW 11 84885272 splice site probably null
R5739:Myo19 UTSW 11 84897624 missense probably damaging 1.00
R5982:Myo19 UTSW 11 84899400 missense probably damaging 0.97
R6093:Myo19 UTSW 11 84885709 missense probably damaging 1.00
R6444:Myo19 UTSW 11 84895308 missense probably benign
R6657:Myo19 UTSW 11 84897196 missense probably benign
R6945:Myo19 UTSW 11 84897560 missense probably benign 0.06
R7022:Myo19 UTSW 11 84900547 missense probably damaging 0.99
R7058:Myo19 UTSW 11 84907368 missense possibly damaging 0.89
R7150:Myo19 UTSW 11 84905613 missense probably benign
R7155:Myo19 UTSW 11 84900586 missense probably damaging 1.00
R7478:Myo19 UTSW 11 84885800 missense probably benign 0.41
R7486:Myo19 UTSW 11 84905637 missense probably benign
R7833:Myo19 UTSW 11 84909267 missense probably benign
R7921:Myo19 UTSW 11 84908238 missense possibly damaging 0.55
R7923:Myo19 UTSW 11 84885710 missense possibly damaging 0.87
R7927:Myo19 UTSW 11 84900220 missense probably damaging 1.00
X0053:Myo19 UTSW 11 84897715 nonsense probably null
Z1176:Myo19 UTSW 11 84885278 missense probably benign 0.05
Z1176:Myo19 UTSW 11 84909350 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCCTGAAATCAACAAGGGG -3'
(R):5'- TGGGAATAGCTTGGCACTTG -3'

Sequencing Primer
(F):5'- AGAAGTGTTCTGATCTTCCAGC -3'
(R):5'- CACTTGCGTGTGGGATCTAATGTC -3'
Posted On2016-10-24