Incidental Mutation 'R5558:Cbx2'
ID436421
Institutional Source Beutler Lab
Gene Symbol Cbx2
Ensembl Gene ENSMUSG00000025577
Gene Namechromobox 2
SynonymsM33
MMRRC Submission 043115-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5558 (G1)
Quality Score185
Status Not validated
Chromosome11
Chromosomal Location119022962-119031270 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119028949 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 447 (T447A)
Ref Sequence ENSEMBL: ENSMUSP00000026662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026662]
Predicted Effect probably benign
Transcript: ENSMUST00000026662
AA Change: T447A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000026662
Gene: ENSMUSG00000025577
AA Change: T447A

DomainStartEndE-ValueType
CHROMO 11 63 5.74e-17 SMART
AT_hook 74 86 2.05e-1 SMART
low complexity region 102 132 N/A INTRINSIC
low complexity region 197 210 N/A INTRINSIC
low complexity region 301 318 N/A INTRINSIC
low complexity region 452 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139746
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the polycomb multiprotein complex, which is required to maintain the transcriptionally repressive state of many genes throughout development via chromatin remodeling and modification of histones. Disruption of this gene in results in male-to-female gonadal sex reversal. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations cause malformations of the axial skeletal, reduced viability, poor growth and male to female sex reversal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A C 3: 88,693,096 H164P probably damaging Het
Abcg4 T C 9: 44,281,408 K177E probably damaging Het
Acvr1 T C 2: 58,459,017 T378A probably damaging Het
Agtpbp1 A G 13: 59,482,580 V779A probably benign Het
Alms1 C T 6: 85,641,329 Q2786* probably null Het
Arhgef28 A C 13: 97,961,460 L882R probably damaging Het
Ch25h A G 19: 34,474,463 W222R probably damaging Het
Chsy3 T G 18: 59,176,397 S241A probably damaging Het
Cyfip1 T C 7: 55,892,001 S345P possibly damaging Het
Cyp4a30b C A 4: 115,458,866 D291E probably damaging Het
Dcstamp A G 15: 39,759,540 Y419C probably damaging Het
Eif3d G A 15: 77,961,847 R359C probably damaging Het
Elavl4 C A 4: 110,206,603 G267V probably benign Het
Gars T C 6: 55,065,607 S442P probably damaging Het
Gas6 C T 8: 13,466,764 R578Q probably null Het
Hist1h4d C A 13: 23,581,796 N65K possibly damaging Het
Ifitm6 T C 7: 141,016,072 I103V probably benign Het
Igsf5 T A 16: 96,386,531 I241N possibly damaging Het
Iqce A G 5: 140,671,805 probably null Het
Kif20b C A 19: 34,951,549 Q1192K probably damaging Het
Lap3 A G 5: 45,504,751 N298D probably benign Het
Lca5 A T 9: 83,401,743 S246T probably damaging Het
Mrps5 G A 2: 127,602,435 G330S probably damaging Het
Myh15 C T 16: 49,069,537 R164C probably benign Het
Myo19 C G 11: 84,910,448 P940R probably damaging Het
Olfr1406 T C 1: 173,184,018 R139G probably benign Het
Olfr1445 T C 19: 12,884,387 F169L probably benign Het
Pcdh10 A G 3: 45,384,168 D920G probably damaging Het
Pgm5 A T 19: 24,824,451 probably null Het
Phactr4 T C 4: 132,378,455 E137G probably damaging Het
Pkn1 C T 8: 83,684,722 V239M probably damaging Het
Plcz1 T A 6: 140,039,755 D20V probably damaging Het
Prkca A T 11: 107,981,647 I429N probably damaging Het
Ptk2 A T 15: 73,304,445 Y251N probably damaging Het
R3hdm2 T C 10: 127,444,402 F31S probably damaging Het
Rab11fip1 T A 8: 27,151,975 E932V probably damaging Het
Rilp A G 11: 75,511,425 Y250C probably damaging Het
Sclt1 A G 3: 41,661,590 I474T probably benign Het
Slc14a2 T A 18: 78,159,166 D583V possibly damaging Het
Slc30a4 A G 2: 122,686,983 I324T probably damaging Het
Slc6a5 G A 7: 49,927,573 V326I probably benign Het
Slco1c1 C T 6: 141,567,496 T617I probably damaging Het
Sntg1 A G 1: 8,414,271 S442P possibly damaging Het
Sys1 G T 2: 164,464,509 A128S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmed5 A G 5: 108,124,596 I212T probably benign Het
Tnks T C 8: 34,965,665 M1V probably null Het
Trpa1 T C 1: 14,898,268 H452R probably damaging Het
Trpm3 T C 19: 22,978,573 V1133A probably damaging Het
Ttn T A 2: 76,725,051 I30537F probably damaging Het
Ush2a T C 1: 188,797,827 V3271A possibly damaging Het
Utp20 C G 10: 88,751,467 G2489R probably damaging Het
Vmn1r70 A T 7: 10,634,475 S278C probably benign Het
Wdpcp G A 11: 21,711,732 A335T probably benign Het
Zc3h18 G T 8: 122,386,920 R217L probably damaging Het
Zfp384 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 6: 125,036,509 probably benign Het
Zfp955b C T 17: 33,302,187 T210I possibly damaging Het
Other mutations in Cbx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1005:Cbx2 UTSW 11 119028574 missense probably benign
R1629:Cbx2 UTSW 11 119028980 missense probably damaging 0.99
R1954:Cbx2 UTSW 11 119028340 missense probably damaging 0.99
R1962:Cbx2 UTSW 11 119028569 missense possibly damaging 0.76
R4674:Cbx2 UTSW 11 119029109 missense probably damaging 1.00
R4675:Cbx2 UTSW 11 119029109 missense probably damaging 1.00
R6446:Cbx2 UTSW 11 119027926 missense probably benign 0.08
R6550:Cbx2 UTSW 11 119029025 missense possibly damaging 0.63
R6610:Cbx2 UTSW 11 119024210 missense probably damaging 1.00
R6622:Cbx2 UTSW 11 119029135 missense probably damaging 0.99
R7095:Cbx2 UTSW 11 119028059 missense probably damaging 1.00
R7132:Cbx2 UTSW 11 119023121 missense probably benign 0.08
R7478:Cbx2 UTSW 11 119029115 missense probably damaging 1.00
R8296:Cbx2 UTSW 11 119028128 missense probably damaging 1.00
R8374:Cbx2 UTSW 11 119028143 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTATTCCTGCTACCAACC -3'
(R):5'- TCACGGTGACAGTGATGAGG -3'

Sequencing Primer
(F):5'- CAGCCACAGGGAAAGGTCCTG -3'
(R):5'- ATGAGGTTGGCTGTGACATCC -3'
Posted On2016-10-24