Mutagenetix > Incidental Mutation

Incidental Mutation 'R5558:Ptk2'

436428

Institutional Source

Beutler Lab

Gene Symbol

Ptk2

Ensembl Gene

ENSMUSG00000022607

Gene Name

PTK2 protein tyrosine kinase 2

Synonyms

FRNK, FAK, Fadk

MMRRC Submission

043115-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5558 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73205102-73423280 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 73304445 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 251 (Y251N)

Ref Sequence

ENSEMBL: ENSMUSP00000154242 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000170939] [ENSMUST00000226791] [ENSMUST00000226988]

AlphaFold

P34152

Predicted Effect

probably damaging
Transcript: ENSMUST00000110036
AA Change: Y251N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607
AA Change: Y251N

Domain	Start	End	E-Value	Type
B41	31	258	1.49e-39	SMART
Blast:B41	288	333	1e-19	BLAST
TyrKc	422	676	1.11e-130	SMART
low complexity region	686	698	N/A	INTRINSIC
low complexity region	712	726	N/A	INTRINSIC
low complexity region	863	883	N/A	INTRINSIC
Pfam:Focal_AT	914	1046	5e-59	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170939
AA Change: Y251N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126764
Gene: ENSMUSG00000022607
AA Change: Y251N

Domain	Start	End	E-Value	Type
B41	31	258	1.49e-39	SMART
Blast:B41	287	333	1e-19	BLAST
TyrKc	422	676	1.11e-130	SMART
low complexity region	686	698	N/A	INTRINSIC
low complexity region	712	726	N/A	INTRINSIC
low complexity region	863	883	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226742

Predicted Effect

probably benign
Transcript: ENSMUST00000226791

Predicted Effect

probably damaging
Transcript: ENSMUST00000226988
AA Change: Y251N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227569

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228628

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810403A07Rik	A	C	3: 88,693,096	H164P	probably damaging	Het
Abcg4	T	C	9: 44,281,408	K177E	probably damaging	Het
Acvr1	T	C	2: 58,459,017	T378A	probably damaging	Het
Agtpbp1	A	G	13: 59,482,580	V779A	probably benign	Het
Alms1	C	T	6: 85,641,329	Q2786*	probably null	Het
Arhgef28	A	C	13: 97,961,460	L882R	probably damaging	Het
Cbx2	A	G	11: 119,028,949	T447A	probably benign	Het
Ch25h	A	G	19: 34,474,463	W222R	probably damaging	Het
Chsy3	T	G	18: 59,176,397	S241A	probably damaging	Het
Cyfip1	T	C	7: 55,892,001	S345P	possibly damaging	Het
Cyp4a30b	C	A	4: 115,458,866	D291E	probably damaging	Het
Dcstamp	A	G	15: 39,759,540	Y419C	probably damaging	Het
Eif3d	G	A	15: 77,961,847	R359C	probably damaging	Het
Elavl4	C	A	4: 110,206,603	G267V	probably benign	Het
Gars	T	C	6: 55,065,607	S442P	probably damaging	Het
Gas6	C	T	8: 13,466,764	R578Q	probably null	Het
Hist1h4d	C	A	13: 23,581,796	N65K	possibly damaging	Het
Ifitm6	T	C	7: 141,016,072	I103V	probably benign	Het
Igsf5	T	A	16: 96,386,531	I241N	possibly damaging	Het
Iqce	A	G	5: 140,671,805		probably null	Het
Kif20b	C	A	19: 34,951,549	Q1192K	probably damaging	Het
Lap3	A	G	5: 45,504,751	N298D	probably benign	Het
Lca5	A	T	9: 83,401,743	S246T	probably damaging	Het
Mrps5	G	A	2: 127,602,435	G330S	probably damaging	Het
Myh15	C	T	16: 49,069,537	R164C	probably benign	Het
Myo19	C	G	11: 84,910,448	P940R	probably damaging	Het
Olfr1406	T	C	1: 173,184,018	R139G	probably benign	Het
Olfr1445	T	C	19: 12,884,387	F169L	probably benign	Het
Pcdh10	A	G	3: 45,384,168	D920G	probably damaging	Het
Pgm5	A	T	19: 24,824,451		probably null	Het
Phactr4	T	C	4: 132,378,455	E137G	probably damaging	Het
Pkn1	C	T	8: 83,684,722	V239M	probably damaging	Het
Plcz1	T	A	6: 140,039,755	D20V	probably damaging	Het
Prkca	A	T	11: 107,981,647	I429N	probably damaging	Het
R3hdm2	T	C	10: 127,444,402	F31S	probably damaging	Het
Rab11fip1	T	A	8: 27,151,975	E932V	probably damaging	Het
Rilp	A	G	11: 75,511,425	Y250C	probably damaging	Het
Sclt1	A	G	3: 41,661,590	I474T	probably benign	Het
Slc14a2	T	A	18: 78,159,166	D583V	possibly damaging	Het
Slc30a4	A	G	2: 122,686,983	I324T	probably damaging	Het
Slc6a5	G	A	7: 49,927,573	V326I	probably benign	Het
Slco1c1	C	T	6: 141,567,496	T617I	probably damaging	Het
Sntg1	A	G	1: 8,414,271	S442P	possibly damaging	Het
Sys1	G	T	2: 164,464,509	A128S	possibly damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Tmed5	A	G	5: 108,124,596	I212T	probably benign	Het
Tnks	T	C	8: 34,965,665	M1V	probably null	Het
Trpa1	T	C	1: 14,898,268	H452R	probably damaging	Het
Trpm3	T	C	19: 22,978,573	V1133A	probably damaging	Het
Ttn	T	A	2: 76,725,051	I30537F	probably damaging	Het
Ush2a	T	C	1: 188,797,827	V3271A	possibly damaging	Het
Utp20	C	G	10: 88,751,467	G2489R	probably damaging	Het
Vmn1r70	A	T	7: 10,634,475	S278C	probably benign	Het
Wdpcp	G	A	11: 21,711,732	A335T	probably benign	Het
Zc3h18	G	T	8: 122,386,920	R217L	probably damaging	Het
Zfp384	ACAGCAGCAGCAGCAGCAGCAGC	ACAGCAGCAGCAGCAGCAGC	6: 125,036,509		probably benign	Het
Zfp955b	C	T	17: 33,302,187	T210I	possibly damaging	Het

Other mutations in Ptk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Ptk2	APN	15	73262547	missense	probably damaging	1.00
IGL00913:Ptk2	APN	15	73295389	splice site	probably benign
IGL01605:Ptk2	APN	15	73264339	splice site	probably benign
IGL01631:Ptk2	APN	15	73216371	missense	probably damaging	1.00
IGL01952:Ptk2	APN	15	73229931	missense	probably damaging	0.99
IGL01957:Ptk2	APN	15	73242473	missense	probably benign	0.05
IGL02441:Ptk2	APN	15	73320826	missense	probably benign	0.16
IGL02471:Ptk2	APN	15	73298187	missense	probably benign	0.41
IGL02621:Ptk2	APN	15	73206145	missense	probably damaging	0.99
IGL03198:Ptk2	APN	15	73236216	missense	probably damaging	1.00
Shooter	UTSW	15	73304444	missense	possibly damaging	0.83
R0239:Ptk2	UTSW	15	73343283	splice site	probably null
R0239:Ptk2	UTSW	15	73343283	splice site	probably null
R1254:Ptk2	UTSW	15	73229970	missense	probably benign	0.01
R1291:Ptk2	UTSW	15	73210756	missense	probably damaging	1.00
R1307:Ptk2	UTSW	15	73292046	missense	probably benign	0.01
R1608:Ptk2	UTSW	15	73262575	missense	probably damaging	0.98
R1690:Ptk2	UTSW	15	73262610	missense	probably damaging	1.00
R1724:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1725:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1740:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1741:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1840:Ptk2	UTSW	15	73210884	missense	probably damaging	1.00
R1956:Ptk2	UTSW	15	73215983	missense	possibly damaging	0.49
R2022:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2092:Ptk2	UTSW	15	73236191	nonsense	probably null
R2114:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2115:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2336:Ptk2	UTSW	15	73266116	missense	probably damaging	1.00
R2571:Ptk2	UTSW	15	73231919	missense	probably damaging	1.00
R4232:Ptk2	UTSW	15	73309849	missense	possibly damaging	0.61
R4245:Ptk2	UTSW	15	73231976	missense	probably benign	0.00
R4594:Ptk2	UTSW	15	73206196	missense	probably damaging	1.00
R4688:Ptk2	UTSW	15	73206225	missense	probably damaging	1.00
R4834:Ptk2	UTSW	15	73216096	splice site	probably null
R4847:Ptk2	UTSW	15	73231956	missense	probably benign
R5682:Ptk2	UTSW	15	73262564	nonsense	probably null
R5858:Ptk2	UTSW	15	73321095	missense	probably benign	0.12
R5951:Ptk2	UTSW	15	73303833	missense	possibly damaging	0.88
R6014:Ptk2	UTSW	15	73304444	missense	possibly damaging	0.83
R6027:Ptk2	UTSW	15	73229913	missense	probably damaging	1.00
R6082:Ptk2	UTSW	15	73276865	missense	probably damaging	1.00
R7025:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7031:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7032:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7077:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7078:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7079:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7090:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7091:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7092:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7136:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7137:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7798:Ptk2	UTSW	15	73295375	missense	probably damaging	1.00
R8057:Ptk2	UTSW	15	73298199	frame shift	probably null
R8235:Ptk2	UTSW	15	73343291	missense	probably benign	0.00
R9106:Ptk2	UTSW	15	73259608	missense	possibly damaging	0.95
R9160:Ptk2	UTSW	15	73216084	missense	probably benign	0.01
R9301:Ptk2	UTSW	15	73274497	missense	probably damaging	1.00
R9448:Ptk2	UTSW	15	73343192	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- AACACCTACTTATGAGCATAGGC -3'
(R):5'- CCTTTCAAACTGGTCTCAGGG -3'

Sequencing Primer
(F):5'- TCCTGCTTTCCCCTATAATTAAGTG -3'
(R):5'- TTCAGGCAGTTTGCCAAC -3'

Posted On

2016-10-24