Incidental Mutation 'R5558:Zfp955b'
ID436431
Institutional Source Beutler Lab
Gene Symbol Zfp955b
Ensembl Gene ENSMUSG00000096910
Gene Namezinc finger protein 955B
SynonymsA430003O12Rik, C430039G02Rik, Gm4455
MMRRC Submission 043115-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5558 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33289649-33303196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 33302187 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 210 (T210I)
Ref Sequence ENSEMBL: ENSMUSP00000097011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099414]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099414
AA Change: T210I

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097011
Gene: ENSMUSG00000096910
AA Change: T210I

DomainStartEndE-ValueType
KRAB 10 70 3.04e-14 SMART
ZnF_C2H2 230 252 7.68e0 SMART
ZnF_C2H2 258 280 5.72e-1 SMART
ZnF_C2H2 290 312 6.75e0 SMART
ZnF_C2H2 318 340 5.81e-2 SMART
ZnF_C2H2 346 368 3.16e-3 SMART
ZnF_C2H2 374 396 1.18e-2 SMART
ZnF_C2H2 402 424 7.78e-3 SMART
ZnF_C2H2 430 452 3.16e-3 SMART
ZnF_C2H2 458 480 1.1e-2 SMART
ZnF_C2H2 486 508 2.09e-3 SMART
ZnF_C2H2 514 536 6.67e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182230
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A C 3: 88,693,096 H164P probably damaging Het
Abcg4 T C 9: 44,281,408 K177E probably damaging Het
Acvr1 T C 2: 58,459,017 T378A probably damaging Het
Agtpbp1 A G 13: 59,482,580 V779A probably benign Het
Alms1 C T 6: 85,641,329 Q2786* probably null Het
Arhgef28 A C 13: 97,961,460 L882R probably damaging Het
Cbx2 A G 11: 119,028,949 T447A probably benign Het
Ch25h A G 19: 34,474,463 W222R probably damaging Het
Chsy3 T G 18: 59,176,397 S241A probably damaging Het
Cyfip1 T C 7: 55,892,001 S345P possibly damaging Het
Cyp4a30b C A 4: 115,458,866 D291E probably damaging Het
Dcstamp A G 15: 39,759,540 Y419C probably damaging Het
Eif3d G A 15: 77,961,847 R359C probably damaging Het
Elavl4 C A 4: 110,206,603 G267V probably benign Het
Gars T C 6: 55,065,607 S442P probably damaging Het
Gas6 C T 8: 13,466,764 R578Q probably null Het
Hist1h4d C A 13: 23,581,796 N65K possibly damaging Het
Ifitm6 T C 7: 141,016,072 I103V probably benign Het
Igsf5 T A 16: 96,386,531 I241N possibly damaging Het
Iqce A G 5: 140,671,805 probably null Het
Kif20b C A 19: 34,951,549 Q1192K probably damaging Het
Lap3 A G 5: 45,504,751 N298D probably benign Het
Lca5 A T 9: 83,401,743 S246T probably damaging Het
Mrps5 G A 2: 127,602,435 G330S probably damaging Het
Myh15 C T 16: 49,069,537 R164C probably benign Het
Myo19 C G 11: 84,910,448 P940R probably damaging Het
Olfr1406 T C 1: 173,184,018 R139G probably benign Het
Olfr1445 T C 19: 12,884,387 F169L probably benign Het
Pcdh10 A G 3: 45,384,168 D920G probably damaging Het
Pgm5 A T 19: 24,824,451 probably null Het
Phactr4 T C 4: 132,378,455 E137G probably damaging Het
Pkn1 C T 8: 83,684,722 V239M probably damaging Het
Plcz1 T A 6: 140,039,755 D20V probably damaging Het
Prkca A T 11: 107,981,647 I429N probably damaging Het
Ptk2 A T 15: 73,304,445 Y251N probably damaging Het
R3hdm2 T C 10: 127,444,402 F31S probably damaging Het
Rab11fip1 T A 8: 27,151,975 E932V probably damaging Het
Rilp A G 11: 75,511,425 Y250C probably damaging Het
Sclt1 A G 3: 41,661,590 I474T probably benign Het
Slc14a2 T A 18: 78,159,166 D583V possibly damaging Het
Slc30a4 A G 2: 122,686,983 I324T probably damaging Het
Slc6a5 G A 7: 49,927,573 V326I probably benign Het
Slco1c1 C T 6: 141,567,496 T617I probably damaging Het
Sntg1 A G 1: 8,414,271 S442P possibly damaging Het
Sys1 G T 2: 164,464,509 A128S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmed5 A G 5: 108,124,596 I212T probably benign Het
Tnks T C 8: 34,965,665 M1V probably null Het
Trpa1 T C 1: 14,898,268 H452R probably damaging Het
Trpm3 T C 19: 22,978,573 V1133A probably damaging Het
Ttn T A 2: 76,725,051 I30537F probably damaging Het
Ush2a T C 1: 188,797,827 V3271A possibly damaging Het
Utp20 C G 10: 88,751,467 G2489R probably damaging Het
Vmn1r70 A T 7: 10,634,475 S278C probably benign Het
Wdpcp G A 11: 21,711,732 A335T probably benign Het
Zc3h18 G T 8: 122,386,920 R217L probably damaging Het
Zfp384 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 6: 125,036,509 probably benign Het
Other mutations in Zfp955b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00537:Zfp955b APN 17 33302873 missense probably damaging 1.00
IGL02073:Zfp955b APN 17 33300590 missense possibly damaging 0.69
IGL02126:Zfp955b APN 17 33302264 nonsense probably null
IGL02237:Zfp955b APN 17 33301919 missense probably damaging 1.00
IGL02587:Zfp955b APN 17 33300650 missense probably damaging 1.00
IGL02971:Zfp955b APN 17 33300966 missense probably benign 0.11
IGL03034:Zfp955b APN 17 33302168 missense probably benign 0.22
IGL03493:Zfp955b APN 17 33302545 missense probably benign 0.35
R0269:Zfp955b UTSW 17 33305463 missense probably damaging 1.00
R0373:Zfp955b UTSW 17 33302522 missense probably benign
R0617:Zfp955b UTSW 17 33305463 missense probably damaging 1.00
R0684:Zfp955b UTSW 17 33302973 missense probably benign 0.00
R1778:Zfp955b UTSW 17 33302814 missense probably benign 0.07
R1874:Zfp955b UTSW 17 33305453 missense probably benign 0.10
R3893:Zfp955b UTSW 17 33302994 missense probably benign 0.01
R3938:Zfp955b UTSW 17 33305416 missense probably damaging 1.00
R4082:Zfp955b UTSW 17 33302155 missense probably benign 0.08
R4672:Zfp955b UTSW 17 33305259 unclassified probably benign
R4956:Zfp955b UTSW 17 33305235 unclassified probably benign
R4998:Zfp955b UTSW 17 33305151 unclassified probably benign
R5276:Zfp955b UTSW 17 33303057 missense probably damaging 1.00
R5341:Zfp955b UTSW 17 33305121 unclassified probably benign
R6086:Zfp955b UTSW 17 33302504 missense probably benign
R6170:Zfp955b UTSW 17 33302110 missense probably benign 0.00
R6306:Zfp955b UTSW 17 33303186 missense probably benign 0.07
R6519:Zfp955b UTSW 17 33302077 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TACAGATGTCAGGAACTCGTG -3'
(R):5'- ACAGGAAAGTTTCACCACAGTG -3'

Sequencing Primer
(F):5'- TCAGGAACTCGTGGAAAAAGCTATC -3'
(R):5'- GGAAAGTTTCACCACAGTGTCTAC -3'
Posted On2016-10-24