Incidental Mutation 'R5558:Olfr1445'
ID436435
Institutional Source Beutler Lab
Gene Symbol Olfr1445
Ensembl Gene ENSMUSG00000045126
Gene Nameolfactory receptor 1445
SynonymsGA_x6K02T2RE5P-3213352-3214296, MOR202-7
MMRRC Submission 043115-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5558 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12883855-12884855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12884387 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 169 (F169L)
Ref Sequence ENSEMBL: ENSMUSP00000058933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049624] [ENSMUST00000216805]
Predicted Effect probably benign
Transcript: ENSMUST00000049624
AA Change: F169L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000058933
Gene: ENSMUSG00000045126
AA Change: F169L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.7e-54 PFAM
Pfam:7tm_1 39 288 4.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216805
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A C 3: 88,693,096 H164P probably damaging Het
Abcg4 T C 9: 44,281,408 K177E probably damaging Het
Acvr1 T C 2: 58,459,017 T378A probably damaging Het
Agtpbp1 A G 13: 59,482,580 V779A probably benign Het
Alms1 C T 6: 85,641,329 Q2786* probably null Het
Arhgef28 A C 13: 97,961,460 L882R probably damaging Het
Cbx2 A G 11: 119,028,949 T447A probably benign Het
Ch25h A G 19: 34,474,463 W222R probably damaging Het
Chsy3 T G 18: 59,176,397 S241A probably damaging Het
Cyfip1 T C 7: 55,892,001 S345P possibly damaging Het
Cyp4a30b C A 4: 115,458,866 D291E probably damaging Het
Dcstamp A G 15: 39,759,540 Y419C probably damaging Het
Eif3d G A 15: 77,961,847 R359C probably damaging Het
Elavl4 C A 4: 110,206,603 G267V probably benign Het
Gars T C 6: 55,065,607 S442P probably damaging Het
Gas6 C T 8: 13,466,764 R578Q probably null Het
Hist1h4d C A 13: 23,581,796 N65K possibly damaging Het
Ifitm6 T C 7: 141,016,072 I103V probably benign Het
Igsf5 T A 16: 96,386,531 I241N possibly damaging Het
Iqce A G 5: 140,671,805 probably null Het
Kif20b C A 19: 34,951,549 Q1192K probably damaging Het
Lap3 A G 5: 45,504,751 N298D probably benign Het
Lca5 A T 9: 83,401,743 S246T probably damaging Het
Mrps5 G A 2: 127,602,435 G330S probably damaging Het
Myh15 C T 16: 49,069,537 R164C probably benign Het
Myo19 C G 11: 84,910,448 P940R probably damaging Het
Olfr1406 T C 1: 173,184,018 R139G probably benign Het
Pcdh10 A G 3: 45,384,168 D920G probably damaging Het
Pgm5 A T 19: 24,824,451 probably null Het
Phactr4 T C 4: 132,378,455 E137G probably damaging Het
Pkn1 C T 8: 83,684,722 V239M probably damaging Het
Plcz1 T A 6: 140,039,755 D20V probably damaging Het
Prkca A T 11: 107,981,647 I429N probably damaging Het
Ptk2 A T 15: 73,304,445 Y251N probably damaging Het
R3hdm2 T C 10: 127,444,402 F31S probably damaging Het
Rab11fip1 T A 8: 27,151,975 E932V probably damaging Het
Rilp A G 11: 75,511,425 Y250C probably damaging Het
Sclt1 A G 3: 41,661,590 I474T probably benign Het
Slc14a2 T A 18: 78,159,166 D583V possibly damaging Het
Slc30a4 A G 2: 122,686,983 I324T probably damaging Het
Slc6a5 G A 7: 49,927,573 V326I probably benign Het
Slco1c1 C T 6: 141,567,496 T617I probably damaging Het
Sntg1 A G 1: 8,414,271 S442P possibly damaging Het
Sys1 G T 2: 164,464,509 A128S possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tmed5 A G 5: 108,124,596 I212T probably benign Het
Tnks T C 8: 34,965,665 M1V probably null Het
Trpa1 T C 1: 14,898,268 H452R probably damaging Het
Trpm3 T C 19: 22,978,573 V1133A probably damaging Het
Ttn T A 2: 76,725,051 I30537F probably damaging Het
Ush2a T C 1: 188,797,827 V3271A possibly damaging Het
Utp20 C G 10: 88,751,467 G2489R probably damaging Het
Vmn1r70 A T 7: 10,634,475 S278C probably benign Het
Wdpcp G A 11: 21,711,732 A335T probably benign Het
Zc3h18 G T 8: 122,386,920 R217L probably damaging Het
Zfp384 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 6: 125,036,509 probably benign Het
Zfp955b C T 17: 33,302,187 T210I possibly damaging Het
Other mutations in Olfr1445
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Olfr1445 APN 19 12883901 missense probably benign 0.03
IGL01786:Olfr1445 APN 19 12884277 missense probably damaging 0.99
IGL02375:Olfr1445 APN 19 12883941 missense probably benign 0.00
IGL03220:Olfr1445 APN 19 12884451 missense possibly damaging 0.80
IGL03232:Olfr1445 APN 19 12884272 nonsense probably null
R0505:Olfr1445 UTSW 19 12884079 missense probably damaging 1.00
R0505:Olfr1445 UTSW 19 12884546 missense probably damaging 1.00
R0541:Olfr1445 UTSW 19 12884094 missense probably damaging 1.00
R0681:Olfr1445 UTSW 19 12884079 missense probably damaging 1.00
R0681:Olfr1445 UTSW 19 12884546 missense probably damaging 1.00
R2187:Olfr1445 UTSW 19 12884255 missense probably damaging 1.00
R2231:Olfr1445 UTSW 19 12883949 missense probably benign 0.00
R3706:Olfr1445 UTSW 19 12883896 missense probably damaging 1.00
R4698:Olfr1445 UTSW 19 12884621 missense probably benign 0.08
R6163:Olfr1445 UTSW 19 12884108 missense probably damaging 1.00
R7057:Olfr1445 UTSW 19 12884642 missense probably damaging 0.98
R7063:Olfr1445 UTSW 19 12884085 missense probably damaging 1.00
R7705:Olfr1445 UTSW 19 12884507 missense probably benign 0.01
R8073:Olfr1445 UTSW 19 12884616 missense probably benign 0.00
R8174:Olfr1445 UTSW 19 12883904 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGGCTGCCATGGCTTATGAC -3'
(R):5'- ACTACTGTGAGGTGGGAAGCAC -3'

Sequencing Primer
(F):5'- CATGGCTTATGACCGCTATGCAG -3'
(R):5'- TGGCGTCCTTCAGATGAAC -3'
Posted On2016-10-24