Mutagenetix > Incidental Mutations

Incidental Mutation 'R5559:Gm8251'

436440

Institutional Source

Beutler Lab

Gene Symbol

Gm8251

Ensembl Gene

ENSMUSG00000091844

Gene Name

predicted gene 8251

Synonyms

MMRRC Submission

043116-MU

Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R5559 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44055952-44061936 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 44058515 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Threonine at position 1141 (R1141T)

Ref Sequence

ENSEMBL: ENSMUSP00000127017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168641]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168641
AA Change: R1141T

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: R1141T

Domain	Start	End	E-Value	Type
Pfam:CCDC168_N	2	202	2.5e-83	PFAM
Pfam:CCDC168_N	200	302	1.7e-26	PFAM
Pfam:CCDC168_N	347	397	2.1e-4	PFAM
Pfam:CCDC168_N	437	581	8.5e-8	PFAM
Pfam:CCDC168_N	663	802	6.3e-5	PFAM
Pfam:CCDC168_N	788	955	1e-9	PFAM
low complexity region	1803	1819	N/A	INTRINSIC
low complexity region	1830	1847	N/A	INTRINSIC
low complexity region	1968	1984	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 94.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310034C09Rik	G	T	16: 88,759,093	R65L	unknown	Het
9930021J03Rik	A	C	19: 29,716,963	F1710C	possibly damaging	Het
Abcc5	A	T	16: 20,338,886	M1307K	probably damaging	Het
Anapc1	A	T	2: 128,680,434	C129*	probably null	Het
Brox	A	T	1: 183,291,988	S39R	possibly damaging	Het
Cd109	T	C	9: 78,660,968	V310A	probably benign	Het
Chd9	G	A	8: 91,015,925		probably null	Het
Chmp2b	A	T	16: 65,540,430	I170N	probably damaging	Het
Cnp	G	T	11: 100,576,417	G62V	probably damaging	Het
Dcp2	C	A	18: 44,405,487	P206T	probably damaging	Het
Dhx57	A	T	17: 80,254,379	V902E	possibly damaging	Het
Dmwd	G	A	7: 19,080,438	V338M	probably damaging	Het
Eva1c	A	G	16: 90,904,251	D258G	probably benign	Het
Fam71e2	A	G	7: 4,758,450	V421A	probably damaging	Het
Flvcr2	T	A	12: 85,804,407	F448L	probably benign	Het
Gchfr	C	T	2: 119,169,706	H23Y	probably benign	Het
Gm11397	T	A	13: 33,404,318	D295E	probably benign	Het
Helz2	T	A	2: 181,230,126	M2617L	probably damaging	Het
Ighv5-9-1	A	T	12: 113,736,125	Y122*	probably null	Het
Lrrtm3	A	G	10: 63,930,266	I514T	probably benign	Het
Nolc1	GAGCAGCAGCAGCAGCAGCAGCAGCAGC	GAGCAGCAGCAGCAGCAGCAGCAGC	19: 46,083,155		probably benign	Het
Obox5	A	T	7: 15,757,597	I21F	probably benign	Het
Olfr566	C	T	7: 102,857,207	G25D	possibly damaging	Het
P2rx2	T	C	5: 110,340,561	I376V	possibly damaging	Het
Poli	A	G	18: 70,509,285	S529P	probably benign	Het
Ruvbl1	T	C	6: 88,473,096	I83T	possibly damaging	Het
Rwdd2a	T	C	9: 86,574,430	S220P	probably damaging	Het
Sf3b3	A	T	8: 110,838,215	D320E	probably benign	Het
Slc6a21	C	A	7: 45,288,429	L390I	possibly damaging	Het
Smarcd1	T	G	15: 99,703,295		probably null	Het
Sp1	T	A	15: 102,408,930	S295T	probably benign	Het
Tas2r104	T	A	6: 131,685,131	H205L	probably damaging	Het
Tmem69	C	G	4: 116,553,191	G194A	probably damaging	Het
Unc5c	G	T	3: 141,803,787	C676F	probably damaging	Het
Unkl	A	G	17: 25,205,713	N52S	probably benign	Het
Vmn1r233	T	C	17: 20,994,577	Y37C	possibly damaging	Het
Vmn1r57	A	G	7: 5,220,899	N141S	probably damaging	Het
Vmn2r50	T	C	7: 10,037,326	Y816C	probably damaging	Het
Vmn2r51	T	A	7: 10,092,201	S540C	probably damaging	Het

Other mutations in Gm8251

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
D3080:Gm8251	UTSW	1	44067335
R0045:Gm8251	UTSW	1	44057205	missense	probably benign
R0110:Gm8251	UTSW	1	44059224	missense	probably benign
R0450:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0469:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0510:Gm8251	UTSW	1	44061097	missense	possibly damaging	0.85
R0602:Gm8251	UTSW	1	44059967	missense	possibly damaging	0.96
R0648:Gm8251	UTSW	1	44056563	missense	possibly damaging	0.73
R0928:Gm8251	UTSW	1	44057228	missense	possibly damaging	0.73
R1056:Gm8251	UTSW	1	44060927	missense	probably damaging	1.00
R1217:Gm8251	UTSW	1	44057179	missense	possibly damaging	0.73
R1232:Gm8251	UTSW	1	44056592	missense	possibly damaging	0.96
R1399:Gm8251	UTSW	1	44061311	missense	possibly damaging	0.93
R1489:Gm8251	UTSW	1	44057790	missense	probably benign	0.18
R1489:Gm8251	UTSW	1	44061507	missense	probably benign	0.06
R1519:Gm8251	UTSW	1	44056970	missense	probably benign	0.33
R1664:Gm8251	UTSW	1	44059227	missense	possibly damaging	0.71
R1828:Gm8251	UTSW	1	44057074	missense	possibly damaging	0.72
R1944:Gm8251	UTSW	1	44061849	missense	probably damaging	0.97
R2032:Gm8251	UTSW	1	44061740	missense	possibly damaging	0.86
R2094:Gm8251	UTSW	1	44059730	missense	probably benign	0.06
R2170:Gm8251	UTSW	1	44056008	missense	probably benign	0.18
R2185:Gm8251	UTSW	1	44061381	missense	probably benign	0.01
R2280:Gm8251	UTSW	1	44056460	missense	possibly damaging	0.53
R2281:Gm8251	UTSW	1	44056460	missense	possibly damaging	0.53
R2339:Gm8251	UTSW	1	44060863	missense	probably benign
R3617:Gm8251	UTSW	1	44060954	missense	probably benign
R3738:Gm8251	UTSW	1	44058866	missense	probably benign	0.33
R4012:Gm8251	UTSW	1	44060969	missense	possibly damaging	0.85
R4034:Gm8251	UTSW	1	44058866	missense	probably benign	0.33
R4344:Gm8251	UTSW	1	44060991	missense	possibly damaging	0.86
R4436:Gm8251	UTSW	1	44056116	missense	probably benign	0.03
R4485:Gm8251	UTSW	1	44060123	missense	probably benign
R4735:Gm8251	UTSW	1	44061701	missense	probably benign
R4782:Gm8251	UTSW	1	44059043	missense	possibly damaging	0.85
R4837:Gm8251	UTSW	1	44061434	missense	possibly damaging	0.93
R4862:Gm8251	UTSW	1	44058018	missense	possibly damaging	0.93
R5247:Gm8251	UTSW	1	44057006	nonsense	probably null
R5347:Gm8251	UTSW	1	44057795	missense	probably benign	0.01
R5355:Gm8251	UTSW	1	44057979	missense	possibly damaging	0.53
R5640:Gm8251	UTSW	1	44061927	missense	probably benign	0.00
R5681:Gm8251	UTSW	1	44061464	missense	possibly damaging	0.93
R5776:Gm8251	UTSW	1	44056505	missense	possibly damaging	0.72
R5919:Gm8251	UTSW	1	44056986	missense	probably benign
R5987:Gm8251	UTSW	1	44057257	missense	probably benign
R6616:Gm8251	UTSW	1	44061474	missense	possibly damaging	0.51
R6677:Gm8251	UTSW	1	44058699	missense	probably benign	0.00
R6830:Gm8251	UTSW	1	44056730	missense	probably benign	0.33
R6906:Gm8251	UTSW	1	44056013	missense	probably benign	0.33
R6909:Gm8251	UTSW	1	44059775	missense	possibly damaging	0.71
R6957:Gm8251	UTSW	1	44057207	missense	probably benign	0.00
R7008:Gm8251	UTSW	1	44059625	missense	probably benign
R7052:Gm8251	UTSW	1	44057306	missense	possibly damaging	0.53
R7176:Gm8251	UTSW	1	44060346	missense	probably benign	0.00
R7190:Gm8251	UTSW	1	44061615	missense	probably benign	0.32
R7296:Gm8251	UTSW	1	44060916	nonsense	probably null
R7347:Gm8251	UTSW	1	44059496	missense	probably damaging	0.99
R7371:Gm8251	UTSW	1	44061377	missense	probably benign
R7375:Gm8251	UTSW	1	44060534	missense	possibly damaging	0.53
R7442:Gm8251	UTSW	1	44058708	missense	possibly damaging	0.84
R7450:Gm8251	UTSW	1	44058773	missense	probably benign	0.33
R7574:Gm8251	UTSW	1	44059433	missense	possibly damaging	0.93
R7586:Gm8251	UTSW	1	44060013	missense	probably benign	0.20
R7739:Gm8251	UTSW	1	44056418	missense	possibly damaging	0.86
R7878:Gm8251	UTSW	1	44056014	missense	probably benign	0.18
R7959:Gm8251	UTSW	1	44057568	missense	probably benign
R7991:Gm8251	UTSW	1	44059709	missense	probably benign	0.00
R8035:Gm8251	UTSW	1	44061551	missense	possibly damaging	0.51
R8281:Gm8251	UTSW	1	44056538	missense	possibly damaging	0.93
R8523:Gm8251	UTSW	1	44060834	missense	possibly damaging	0.86
YA93:Gm8251	UTSW	1	44065085	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- AGCATCTGGTAATTTCTCCTGG -3'
(R):5'- CAGTCAAGGGTACGCATGAG -3'

Sequencing Primer
(F):5'- GCATCTGGTAATTTCTCCTGGAATTC -3'
(R):5'- CATGAGTAATAAGGCGGTTTGTGAC -3'

Posted On

2016-10-24