Incidental Mutation 'R5559:Gm8251'
ID436440
Institutional Source Beutler Lab
Gene Symbol Gm8251
Ensembl Gene ENSMUSG00000091844
Gene Namepredicted gene 8251
Synonyms
MMRRC Submission 043116-MU
Accession Numbers

Genbank: XM_985572; MGI: 3647616

Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5559 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location44055952-44061936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 44058515 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Threonine at position 1141 (R1141T)
Ref Sequence ENSEMBL: ENSMUSP00000127017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168641]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168641
AA Change: R1141T

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127017
Gene: ENSMUSG00000091844
AA Change: R1141T

DomainStartEndE-ValueType
Pfam:CCDC168_N 2 202 2.5e-83 PFAM
Pfam:CCDC168_N 200 302 1.7e-26 PFAM
Pfam:CCDC168_N 347 397 2.1e-4 PFAM
Pfam:CCDC168_N 437 581 8.5e-8 PFAM
Pfam:CCDC168_N 663 802 6.3e-5 PFAM
Pfam:CCDC168_N 788 955 1e-9 PFAM
low complexity region 1803 1819 N/A INTRINSIC
low complexity region 1830 1847 N/A INTRINSIC
low complexity region 1968 1984 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G T 16: 88,759,093 R65L unknown Het
9930021J03Rik A C 19: 29,716,963 F1710C possibly damaging Het
Abcc5 A T 16: 20,338,886 M1307K probably damaging Het
Anapc1 A T 2: 128,680,434 C129* probably null Het
Brox A T 1: 183,291,988 S39R possibly damaging Het
Cd109 T C 9: 78,660,968 V310A probably benign Het
Chd9 G A 8: 91,015,925 probably null Het
Chmp2b A T 16: 65,540,430 I170N probably damaging Het
Cnp G T 11: 100,576,417 G62V probably damaging Het
Dcp2 C A 18: 44,405,487 P206T probably damaging Het
Dhx57 A T 17: 80,254,379 V902E possibly damaging Het
Dmwd G A 7: 19,080,438 V338M probably damaging Het
Eva1c A G 16: 90,904,251 D258G probably benign Het
Fam71e2 A G 7: 4,758,450 V421A probably damaging Het
Flvcr2 T A 12: 85,804,407 F448L probably benign Het
Gchfr C T 2: 119,169,706 H23Y probably benign Het
Gm11397 T A 13: 33,404,318 D295E probably benign Het
Helz2 T A 2: 181,230,126 M2617L probably damaging Het
Ighv5-9-1 A T 12: 113,736,125 Y122* probably null Het
Lrrtm3 A G 10: 63,930,266 I514T probably benign Het
Nolc1 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,083,155 probably benign Het
Obox5 A T 7: 15,757,597 I21F probably benign Het
Olfr566 C T 7: 102,857,207 G25D possibly damaging Het
P2rx2 T C 5: 110,340,561 I376V possibly damaging Het
Poli A G 18: 70,509,285 S529P probably benign Het
Ruvbl1 T C 6: 88,473,096 I83T possibly damaging Het
Rwdd2a T C 9: 86,574,430 S220P probably damaging Het
Sf3b3 A T 8: 110,838,215 D320E probably benign Het
Slc6a21 C A 7: 45,288,429 L390I possibly damaging Het
Smarcd1 T G 15: 99,703,295 probably null Het
Sp1 T A 15: 102,408,930 S295T probably benign Het
Tas2r104 T A 6: 131,685,131 H205L probably damaging Het
Tmem69 C G 4: 116,553,191 G194A probably damaging Het
Unc5c G T 3: 141,803,787 C676F probably damaging Het
Unkl A G 17: 25,205,713 N52S probably benign Het
Vmn1r233 T C 17: 20,994,577 Y37C possibly damaging Het
Vmn1r57 A G 7: 5,220,899 N141S probably damaging Het
Vmn2r50 T C 7: 10,037,326 Y816C probably damaging Het
Vmn2r51 T A 7: 10,092,201 S540C probably damaging Het
Other mutations in Gm8251
AlleleSourceChrCoordTypePredicted EffectPPH Score
D3080:Gm8251 UTSW 1 44067335
R0045:Gm8251 UTSW 1 44057205 missense probably benign
R0110:Gm8251 UTSW 1 44059224 missense probably benign
R0450:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0469:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0510:Gm8251 UTSW 1 44061097 missense possibly damaging 0.85
R0602:Gm8251 UTSW 1 44059967 missense possibly damaging 0.96
R0648:Gm8251 UTSW 1 44056563 missense possibly damaging 0.73
R0928:Gm8251 UTSW 1 44057228 missense possibly damaging 0.73
R1056:Gm8251 UTSW 1 44060927 missense probably damaging 1.00
R1217:Gm8251 UTSW 1 44057179 missense possibly damaging 0.73
R1232:Gm8251 UTSW 1 44056592 missense possibly damaging 0.96
R1399:Gm8251 UTSW 1 44061311 missense possibly damaging 0.93
R1489:Gm8251 UTSW 1 44057790 missense probably benign 0.18
R1489:Gm8251 UTSW 1 44061507 missense probably benign 0.06
R1519:Gm8251 UTSW 1 44056970 missense probably benign 0.33
R1664:Gm8251 UTSW 1 44059227 missense possibly damaging 0.71
R1828:Gm8251 UTSW 1 44057074 missense possibly damaging 0.72
R1944:Gm8251 UTSW 1 44061849 missense probably damaging 0.97
R2032:Gm8251 UTSW 1 44061740 missense possibly damaging 0.86
R2094:Gm8251 UTSW 1 44059730 missense probably benign 0.06
R2170:Gm8251 UTSW 1 44056008 missense probably benign 0.18
R2185:Gm8251 UTSW 1 44061381 missense probably benign 0.01
R2280:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2281:Gm8251 UTSW 1 44056460 missense possibly damaging 0.53
R2339:Gm8251 UTSW 1 44060863 missense probably benign
R3617:Gm8251 UTSW 1 44060954 missense probably benign
R3738:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4012:Gm8251 UTSW 1 44060969 missense possibly damaging 0.85
R4034:Gm8251 UTSW 1 44058866 missense probably benign 0.33
R4344:Gm8251 UTSW 1 44060991 missense possibly damaging 0.86
R4436:Gm8251 UTSW 1 44056116 missense probably benign 0.03
R4485:Gm8251 UTSW 1 44060123 missense probably benign
R4735:Gm8251 UTSW 1 44061701 missense probably benign
R4782:Gm8251 UTSW 1 44059043 missense possibly damaging 0.85
R4837:Gm8251 UTSW 1 44061434 missense possibly damaging 0.93
R4862:Gm8251 UTSW 1 44058018 missense possibly damaging 0.93
R5247:Gm8251 UTSW 1 44057006 nonsense probably null
R5347:Gm8251 UTSW 1 44057795 missense probably benign 0.01
R5355:Gm8251 UTSW 1 44057979 missense possibly damaging 0.53
R5640:Gm8251 UTSW 1 44061927 missense probably benign 0.00
R5681:Gm8251 UTSW 1 44061464 missense possibly damaging 0.93
R5776:Gm8251 UTSW 1 44056505 missense possibly damaging 0.72
R5919:Gm8251 UTSW 1 44056986 missense probably benign
R5987:Gm8251 UTSW 1 44057257 missense probably benign
R6616:Gm8251 UTSW 1 44061474 missense possibly damaging 0.51
R6677:Gm8251 UTSW 1 44058699 missense probably benign 0.00
R6830:Gm8251 UTSW 1 44056730 missense probably benign 0.33
R6906:Gm8251 UTSW 1 44056013 missense probably benign 0.33
R6909:Gm8251 UTSW 1 44059775 missense possibly damaging 0.71
R6957:Gm8251 UTSW 1 44057207 missense probably benign 0.00
R7008:Gm8251 UTSW 1 44059625 missense probably benign
R7052:Gm8251 UTSW 1 44057306 missense possibly damaging 0.53
R7176:Gm8251 UTSW 1 44060346 missense probably benign 0.00
R7190:Gm8251 UTSW 1 44061615 missense probably benign 0.32
R7296:Gm8251 UTSW 1 44060916 nonsense probably null
R7347:Gm8251 UTSW 1 44059496 missense probably damaging 0.99
R7371:Gm8251 UTSW 1 44061377 missense probably benign
R7375:Gm8251 UTSW 1 44060534 missense possibly damaging 0.53
R7442:Gm8251 UTSW 1 44058708 missense possibly damaging 0.84
R7450:Gm8251 UTSW 1 44058773 missense probably benign 0.33
R7574:Gm8251 UTSW 1 44059433 missense possibly damaging 0.93
R7586:Gm8251 UTSW 1 44060013 missense probably benign 0.20
R7739:Gm8251 UTSW 1 44056418 missense possibly damaging 0.86
R7878:Gm8251 UTSW 1 44056014 missense probably benign 0.18
R7959:Gm8251 UTSW 1 44057568 missense probably benign
R7991:Gm8251 UTSW 1 44059709 missense probably benign 0.00
R8035:Gm8251 UTSW 1 44061551 missense possibly damaging 0.51
R8281:Gm8251 UTSW 1 44056538 missense possibly damaging 0.93
R8523:Gm8251 UTSW 1 44060834 missense possibly damaging 0.86
YA93:Gm8251 UTSW 1 44065085 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCATCTGGTAATTTCTCCTGG -3'
(R):5'- CAGTCAAGGGTACGCATGAG -3'

Sequencing Primer
(F):5'- GCATCTGGTAATTTCTCCTGGAATTC -3'
(R):5'- CATGAGTAATAAGGCGGTTTGTGAC -3'
Posted On2016-10-24