Incidental Mutation 'R5559:Ighv5-9-1'
ID 436469
Institutional Source Beutler Lab
Gene Symbol Ighv5-9-1
Ensembl Gene ENSMUSG00000095210
Gene Name immunoglobulin heavy variable 5-9-1
Synonyms Gm16886
MMRRC Submission 043116-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock # R5559 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 113736111-113736630 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 113736125 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 122 (Y122*)
Ref Sequence ENSEMBL: ENSMUSP00000141243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103452] [ENSMUST00000192264]
AlphaFold A0A075B5Q6
Predicted Effect probably null
Transcript: ENSMUST00000103452
AA Change: Y112*
SMART Domains Protein: ENSMUSP00000100233
Gene: ENSMUSG00000095210
AA Change: Y112*

DomainStartEndE-ValueType
IGv 35 116 8.34e-33 SMART
Predicted Effect probably null
Transcript: ENSMUST00000192264
AA Change: Y122*
SMART Domains Protein: ENSMUSP00000141243
Gene: ENSMUSG00000095210
AA Change: Y122*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGv 45 126 3.3e-35 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G T 16: 88,759,093 R65L unknown Het
9930021J03Rik A C 19: 29,716,963 F1710C possibly damaging Het
Abcc5 A T 16: 20,338,886 M1307K probably damaging Het
Anapc1 A T 2: 128,680,434 C129* probably null Het
Brox A T 1: 183,291,988 S39R possibly damaging Het
Cd109 T C 9: 78,660,968 V310A probably benign Het
Chd9 G A 8: 91,015,925 probably null Het
Chmp2b A T 16: 65,540,430 I170N probably damaging Het
Cnp G T 11: 100,576,417 G62V probably damaging Het
Dcp2 C A 18: 44,405,487 P206T probably damaging Het
Dhx57 A T 17: 80,254,379 V902E possibly damaging Het
Dmwd G A 7: 19,080,438 V338M probably damaging Het
Eva1c A G 16: 90,904,251 D258G probably benign Het
Fam71e2 A G 7: 4,758,450 V421A probably damaging Het
Flvcr2 T A 12: 85,804,407 F448L probably benign Het
Gchfr C T 2: 119,169,706 H23Y probably benign Het
Gm11397 T A 13: 33,404,318 D295E probably benign Het
Gm8251 C G 1: 44,058,515 R1141T possibly damaging Het
Helz2 T A 2: 181,230,126 M2617L probably damaging Het
Lrrtm3 A G 10: 63,930,266 I514T probably benign Het
Nolc1 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,083,155 probably benign Het
Obox5 A T 7: 15,757,597 I21F probably benign Het
Olfr566 C T 7: 102,857,207 G25D possibly damaging Het
P2rx2 T C 5: 110,340,561 I376V possibly damaging Het
Poli A G 18: 70,509,285 S529P probably benign Het
Ruvbl1 T C 6: 88,473,096 I83T possibly damaging Het
Rwdd2a T C 9: 86,574,430 S220P probably damaging Het
Sf3b3 A T 8: 110,838,215 D320E probably benign Het
Slc6a21 C A 7: 45,288,429 L390I possibly damaging Het
Smarcd1 T G 15: 99,703,295 probably null Het
Sp1 T A 15: 102,408,930 S295T probably benign Het
Tas2r104 T A 6: 131,685,131 H205L probably damaging Het
Tmem69 C G 4: 116,553,191 G194A probably damaging Het
Unc5c G T 3: 141,803,787 C676F probably damaging Het
Unkl A G 17: 25,205,713 N52S probably benign Het
Vmn1r233 T C 17: 20,994,577 Y37C possibly damaging Het
Vmn1r57 A G 7: 5,220,899 N141S probably damaging Het
Vmn2r50 T C 7: 10,037,326 Y816C probably damaging Het
Vmn2r51 T A 7: 10,092,201 S540C probably damaging Het
Other mutations in Ighv5-9-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Ighv5-9-1 APN 12 113736390 missense probably damaging 1.00
R4921:Ighv5-9-1 UTSW 12 113736294 missense possibly damaging 0.61
R5161:Ighv5-9-1 UTSW 12 113736157 missense possibly damaging 0.70
R5678:Ighv5-9-1 UTSW 12 113736587 missense possibly damaging 0.72
R7529:Ighv5-9-1 UTSW 12 113736334 missense possibly damaging 0.91
R7618:Ighv5-9-1 UTSW 12 113736199 missense probably damaging 0.99
R7791:Ighv5-9-1 UTSW 12 113736545 missense probably damaging 0.99
R9272:Ighv5-9-1 UTSW 12 113736198 missense probably damaging 1.00
R9331:Ighv5-9-1 UTSW 12 113736258 missense possibly damaging 0.80
Z1088:Ighv5-9-1 UTSW 12 113736120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCCATTACCCCAAGGACTTT -3'
(R):5'- CGCCAGACTCCAGAGAAGA -3'

Sequencing Primer
(F):5'- GTGCCTGCCTATGAGATAGATCC -3'
(R):5'- AGGCTGGAGTGGGTCGC -3'
Posted On 2016-10-24