Incidental Mutation 'R5559:Sp1'
ID436473
Institutional Source Beutler Lab
Gene Symbol Sp1
Ensembl Gene ENSMUSG00000001280
Gene Nametrans-acting transcription factor 1
SynonymsSp1-1, 1110003E12Rik
MMRRC Submission 043116-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5559 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102406143-102436404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102408930 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 295 (S295T)
Ref Sequence ENSEMBL: ENSMUSP00000001326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001326] [ENSMUST00000163709] [ENSMUST00000165837] [ENSMUST00000165924] [ENSMUST00000168802] [ENSMUST00000169619] [ENSMUST00000170884]
Predicted Effect probably benign
Transcript: ENSMUST00000001326
AA Change: S295T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000001326
Gene: ENSMUSG00000001280
AA Change: S295T

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 37 62 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 279 296 N/A INTRINSIC
low complexity region 300 333 N/A INTRINSIC
low complexity region 341 354 N/A INTRINSIC
low complexity region 370 422 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
ZnF_C2H2 624 648 4.34e0 SMART
ZnF_C2H2 654 678 1.98e-4 SMART
ZnF_C2H2 684 706 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163709
SMART Domains Protein: ENSMUSP00000130747
Gene: ENSMUSG00000001280

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 37 108 N/A INTRINSIC
low complexity region 150 166 N/A INTRINSIC
ZnF_C2H2 310 334 4.34e0 SMART
ZnF_C2H2 340 364 1.98e-4 SMART
ZnF_C2H2 370 392 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165837
SMART Domains Protein: ENSMUSP00000126143
Gene: ENSMUSG00000001280

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 55 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165924
AA Change: S295T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132401
Gene: ENSMUSG00000001280
AA Change: S295T

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 37 62 N/A INTRINSIC
low complexity region 74 90 N/A INTRINSIC
low complexity region 279 296 N/A INTRINSIC
low complexity region 300 333 N/A INTRINSIC
low complexity region 341 354 N/A INTRINSIC
low complexity region 370 422 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
ZnF_C2H2 624 648 4.34e0 SMART
ZnF_C2H2 654 678 1.98e-4 SMART
ZnF_C2H2 684 706 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168802
SMART Domains Protein: ENSMUSP00000127445
Gene: ENSMUSG00000001280

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 55 N/A INTRINSIC
low complexity region 67 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169619
SMART Domains Protein: ENSMUSP00000127714
Gene: ENSMUSG00000001280

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170884
SMART Domains Protein: ENSMUSP00000129638
Gene: ENSMUSG00000001280

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 30 55 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that binds to GC-rich motifs of many promoters. The encoded protein is involved in many cellular processes, including cell differentiation, cell growth, apoptosis, immune responses, response to DNA damage, and chromatin remodeling. Post-translational modifications such as phosphorylation, acetylation, glycosylation, and proteolytic processing significantly affect the activity of this protein, which can be an activator or a repressor. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display reduced embryo size and die during organogenesis with a broad range of developmental defects. Heterozygous null mice are viable but slightly growth retarded, may lack one or both eyes, and show a decreased erythroid progenitor cell number in fetal liver cultures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G T 16: 88,759,093 R65L unknown Het
9930021J03Rik A C 19: 29,716,963 F1710C possibly damaging Het
Abcc5 A T 16: 20,338,886 M1307K probably damaging Het
Anapc1 A T 2: 128,680,434 C129* probably null Het
Brox A T 1: 183,291,988 S39R possibly damaging Het
Cd109 T C 9: 78,660,968 V310A probably benign Het
Chd9 G A 8: 91,015,925 probably null Het
Chmp2b A T 16: 65,540,430 I170N probably damaging Het
Cnp G T 11: 100,576,417 G62V probably damaging Het
Dcp2 C A 18: 44,405,487 P206T probably damaging Het
Dhx57 A T 17: 80,254,379 V902E possibly damaging Het
Dmwd G A 7: 19,080,438 V338M probably damaging Het
Eva1c A G 16: 90,904,251 D258G probably benign Het
Fam71e2 A G 7: 4,758,450 V421A probably damaging Het
Flvcr2 T A 12: 85,804,407 F448L probably benign Het
Gchfr C T 2: 119,169,706 H23Y probably benign Het
Gm11397 T A 13: 33,404,318 D295E probably benign Het
Gm8251 C G 1: 44,058,515 R1141T possibly damaging Het
Helz2 T A 2: 181,230,126 M2617L probably damaging Het
Ighv5-9-1 A T 12: 113,736,125 Y122* probably null Het
Lrrtm3 A G 10: 63,930,266 I514T probably benign Het
Nolc1 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,083,155 probably benign Het
Obox5 A T 7: 15,757,597 I21F probably benign Het
Olfr566 C T 7: 102,857,207 G25D possibly damaging Het
P2rx2 T C 5: 110,340,561 I376V possibly damaging Het
Poli A G 18: 70,509,285 S529P probably benign Het
Ruvbl1 T C 6: 88,473,096 I83T possibly damaging Het
Rwdd2a T C 9: 86,574,430 S220P probably damaging Het
Sf3b3 A T 8: 110,838,215 D320E probably benign Het
Slc6a21 C A 7: 45,288,429 L390I possibly damaging Het
Smarcd1 T G 15: 99,703,295 probably null Het
Tas2r104 T A 6: 131,685,131 H205L probably damaging Het
Tmem69 C G 4: 116,553,191 G194A probably damaging Het
Unc5c G T 3: 141,803,787 C676F probably damaging Het
Unkl A G 17: 25,205,713 N52S probably benign Het
Vmn1r233 T C 17: 20,994,577 Y37C possibly damaging Het
Vmn1r57 A G 7: 5,220,899 N141S probably damaging Het
Vmn2r50 T C 7: 10,037,326 Y816C probably damaging Het
Vmn2r51 T A 7: 10,092,201 S540C probably damaging Het
Other mutations in Sp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Sp1 APN 15 102430929 missense probably damaging 1.00
PIT4812001:Sp1 UTSW 15 102408408 missense possibly damaging 0.53
R0758:Sp1 UTSW 15 102406370 splice site probably null
R1509:Sp1 UTSW 15 102407879 missense possibly damaging 0.66
R1611:Sp1 UTSW 15 102430935 missense probably damaging 0.99
R1820:Sp1 UTSW 15 102409076 missense possibly damaging 0.73
R1824:Sp1 UTSW 15 102431003 missense possibly damaging 0.70
R2107:Sp1 UTSW 15 102409678 splice site probably null
R4508:Sp1 UTSW 15 102409312 missense possibly damaging 0.53
R4857:Sp1 UTSW 15 102430974 missense probably damaging 0.99
R5512:Sp1 UTSW 15 102431010 missense possibly damaging 0.91
R5833:Sp1 UTSW 15 102430917 missense possibly damaging 0.92
R6377:Sp1 UTSW 15 102430883 missense probably benign 0.13
R8059:Sp1 UTSW 15 102407902 missense possibly damaging 0.73
R8434:Sp1 UTSW 15 102409683 missense probably benign 0.00
R8537:Sp1 UTSW 15 102408529 missense possibly damaging 0.86
X0050:Sp1 UTSW 15 102409411 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTACTCCAGCAGGCTGTC -3'
(R):5'- GAATCAGACCCTTGTAGCCC -3'

Sequencing Primer
(F):5'- AGGCTGTCCCCCTTCAAG -3'
(R):5'- TGTAGCCCACCAACCCTCTG -3'
Posted On2016-10-24