Incidental Mutation 'R5559:Dhx57'
ID436481
Institutional Source Beutler Lab
Gene Symbol Dhx57
Ensembl Gene ENSMUSG00000035051
Gene NameDEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57
Synonyms
MMRRC Submission 043116-MU
Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R5559 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location80238304-80290476 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80254379 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 902 (V902E)
Ref Sequence ENSEMBL: ENSMUSP00000083742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]
Predicted Effect probably benign
Transcript: ENSMUST00000038166
AA Change: V849E

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: V849E

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 116 125 N/A INTRINSIC
UBA 129 166 1.04e-3 SMART
ZnF_C3H1 246 272 4.07e-6 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 381 390 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
DEXDc 490 678 1.27e-28 SMART
Blast:DEXDc 688 752 2e-28 BLAST
HELICc 810 918 3.22e-16 SMART
HA2 984 1074 1.64e-24 SMART
Pfam:OB_NTP_bind 1113 1262 1.5e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000086555
AA Change: V902E

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: V902E

DomainStartEndE-ValueType
low complexity region 6 50 N/A INTRINSIC
low complexity region 169 178 N/A INTRINSIC
UBA 182 219 1.04e-3 SMART
ZnF_C3H1 299 325 4.07e-6 SMART
low complexity region 410 421 N/A INTRINSIC
low complexity region 434 443 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
DEXDc 543 731 1.27e-28 SMART
Blast:DEXDc 741 805 1e-28 BLAST
HELICc 863 971 3.22e-16 SMART
HA2 1037 1127 1.64e-24 SMART
Pfam:OB_NTP_bind 1166 1315 8.5e-25 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G T 16: 88,759,093 R65L unknown Het
9930021J03Rik A C 19: 29,716,963 F1710C possibly damaging Het
Abcc5 A T 16: 20,338,886 M1307K probably damaging Het
Anapc1 A T 2: 128,680,434 C129* probably null Het
Brox A T 1: 183,291,988 S39R possibly damaging Het
Cd109 T C 9: 78,660,968 V310A probably benign Het
Chd9 G A 8: 91,015,925 probably null Het
Chmp2b A T 16: 65,540,430 I170N probably damaging Het
Cnp G T 11: 100,576,417 G62V probably damaging Het
Dcp2 C A 18: 44,405,487 P206T probably damaging Het
Dmwd G A 7: 19,080,438 V338M probably damaging Het
Eva1c A G 16: 90,904,251 D258G probably benign Het
Fam71e2 A G 7: 4,758,450 V421A probably damaging Het
Flvcr2 T A 12: 85,804,407 F448L probably benign Het
Gchfr C T 2: 119,169,706 H23Y probably benign Het
Gm11397 T A 13: 33,404,318 D295E probably benign Het
Gm8251 C G 1: 44,058,515 R1141T possibly damaging Het
Helz2 T A 2: 181,230,126 M2617L probably damaging Het
Ighv5-9-1 A T 12: 113,736,125 Y122* probably null Het
Lrrtm3 A G 10: 63,930,266 I514T probably benign Het
Nolc1 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,083,155 probably benign Het
Obox5 A T 7: 15,757,597 I21F probably benign Het
Olfr566 C T 7: 102,857,207 G25D possibly damaging Het
P2rx2 T C 5: 110,340,561 I376V possibly damaging Het
Poli A G 18: 70,509,285 S529P probably benign Het
Ruvbl1 T C 6: 88,473,096 I83T possibly damaging Het
Rwdd2a T C 9: 86,574,430 S220P probably damaging Het
Sf3b3 A T 8: 110,838,215 D320E probably benign Het
Slc6a21 C A 7: 45,288,429 L390I possibly damaging Het
Smarcd1 T G 15: 99,703,295 probably null Het
Sp1 T A 15: 102,408,930 S295T probably benign Het
Tas2r104 T A 6: 131,685,131 H205L probably damaging Het
Tmem69 C G 4: 116,553,191 G194A probably damaging Het
Unc5c G T 3: 141,803,787 C676F probably damaging Het
Unkl A G 17: 25,205,713 N52S probably benign Het
Vmn1r233 T C 17: 20,994,577 Y37C possibly damaging Het
Vmn1r57 A G 7: 5,220,899 N141S probably damaging Het
Vmn2r50 T C 7: 10,037,326 Y816C probably damaging Het
Vmn2r51 T A 7: 10,092,201 S540C probably damaging Het
Other mutations in Dhx57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Dhx57 APN 17 80274976 missense probably benign 0.00
IGL00811:Dhx57 APN 17 80253243 missense probably damaging 1.00
IGL01389:Dhx57 APN 17 80281223 missense probably benign 0.28
IGL01468:Dhx57 APN 17 80255610 nonsense probably null
IGL01908:Dhx57 APN 17 80251443 missense probably damaging 1.00
IGL01965:Dhx57 APN 17 80268850 missense probably damaging 1.00
IGL02147:Dhx57 APN 17 80260323 missense possibly damaging 0.95
IGL02275:Dhx57 APN 17 80274839 missense probably benign 0.13
IGL02349:Dhx57 APN 17 80255571 missense probably damaging 1.00
IGL02405:Dhx57 APN 17 80255550 critical splice donor site probably null
IGL02588:Dhx57 APN 17 80268871 missense probably damaging 1.00
IGL02673:Dhx57 APN 17 80267545 missense probably damaging 1.00
IGL02836:Dhx57 APN 17 80267549 missense probably damaging 1.00
IGL02889:Dhx57 APN 17 80247152 missense possibly damaging 0.90
IGL03085:Dhx57 APN 17 80258097 missense possibly damaging 0.48
P0014:Dhx57 UTSW 17 80275191 missense probably benign 0.00
PIT4377001:Dhx57 UTSW 17 80263975 missense probably damaging 0.96
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0100:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
R0129:Dhx57 UTSW 17 80238914 missense probably damaging 1.00
R0200:Dhx57 UTSW 17 80251473 missense probably damaging 1.00
R0309:Dhx57 UTSW 17 80274881 missense probably damaging 1.00
R0375:Dhx57 UTSW 17 80258121 missense probably damaging 1.00
R0396:Dhx57 UTSW 17 80274797 missense probably benign 0.34
R0520:Dhx57 UTSW 17 80258175 missense possibly damaging 0.95
R0554:Dhx57 UTSW 17 80260236 nonsense probably null
R0661:Dhx57 UTSW 17 80268864 missense probably damaging 1.00
R0883:Dhx57 UTSW 17 80270371 missense probably damaging 1.00
R0900:Dhx57 UTSW 17 80275582 missense probably benign
R0963:Dhx57 UTSW 17 80275527 missense probably benign 0.01
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1469:Dhx57 UTSW 17 80254418 missense probably damaging 1.00
R1660:Dhx57 UTSW 17 80245728 missense possibly damaging 0.83
R1707:Dhx57 UTSW 17 80275226 missense probably damaging 0.96
R1822:Dhx57 UTSW 17 80253085 critical splice donor site probably null
R1853:Dhx57 UTSW 17 80274879 nonsense probably null
R1942:Dhx57 UTSW 17 80265144 missense probably damaging 1.00
R2043:Dhx57 UTSW 17 80253080 splice site probably benign
R2106:Dhx57 UTSW 17 80275363 missense probably damaging 1.00
R2127:Dhx57 UTSW 17 80273048 missense probably damaging 1.00
R2183:Dhx57 UTSW 17 80275331 missense probably benign 0.07
R2249:Dhx57 UTSW 17 80281234 missense probably damaging 0.98
R2400:Dhx57 UTSW 17 80260416 missense probably damaging 0.99
R2404:Dhx57 UTSW 17 80254304 missense probably damaging 0.98
R2513:Dhx57 UTSW 17 80241949 splice site probably null
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2869:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2870:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2871:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R2874:Dhx57 UTSW 17 80251376 missense probably benign 0.22
R3819:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R3964:Dhx57 UTSW 17 80265112 nonsense probably null
R4535:Dhx57 UTSW 17 80275082 missense probably damaging 1.00
R4666:Dhx57 UTSW 17 80274961 missense probably damaging 1.00
R4788:Dhx57 UTSW 17 80275331 missense probably benign 0.01
R4822:Dhx57 UTSW 17 80242167 splice site probably null
R4863:Dhx57 UTSW 17 80253111 missense probably damaging 1.00
R4988:Dhx57 UTSW 17 80251398 missense probably damaging 1.00
R5391:Dhx57 UTSW 17 80275081 missense probably damaging 1.00
R5644:Dhx57 UTSW 17 80238873 missense possibly damaging 0.73
R5997:Dhx57 UTSW 17 80245806 missense probably damaging 0.96
R6090:Dhx57 UTSW 17 80263946 critical splice donor site probably null
R6177:Dhx57 UTSW 17 80272966 missense possibly damaging 0.91
R6283:Dhx57 UTSW 17 80274805 missense probably benign 0.00
R6802:Dhx57 UTSW 17 80275321 missense probably benign 0.43
R6924:Dhx57 UTSW 17 80238815 missense possibly damaging 0.71
R7151:Dhx57 UTSW 17 80273047 missense probably damaging 1.00
R7386:Dhx57 UTSW 17 80267577 missense possibly damaging 0.89
R7393:Dhx57 UTSW 17 80255571 missense probably damaging 1.00
R7451:Dhx57 UTSW 17 80247113 missense probably damaging 1.00
R7602:Dhx57 UTSW 17 80274861 missense probably benign 0.06
R7733:Dhx57 UTSW 17 80265074 critical splice donor site probably null
R7748:Dhx57 UTSW 17 80265117 missense probably damaging 1.00
R7749:Dhx57 UTSW 17 80238858 missense probably benign 0.04
R7772:Dhx57 UTSW 17 80273078 missense possibly damaging 0.71
R8213:Dhx57 UTSW 17 80275156 missense possibly damaging 0.82
Z1088:Dhx57 UTSW 17 80251348 missense probably damaging 1.00
Z1176:Dhx57 UTSW 17 80245805 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACCATTAAGAGCCGTGTTATCC -3'
(R):5'- GCTGTGCTCAAAGCTGACAG -3'

Sequencing Primer
(F):5'- GCCGTGTTATCCTAAAAGAGGTTAG -3'
(R):5'- ACCATGGCAGCTCTTATGAG -3'
Posted On2016-10-24