Incidental Mutation 'R5559:Dcp2'
ID436482
Institutional Source Beutler Lab
Gene Symbol Dcp2
Ensembl Gene ENSMUSG00000024472
Gene Namedecapping mRNA 2
Synonyms
MMRRC Submission 043116-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R5559 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location44380502-44424969 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44405487 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 206 (P206T)
Ref Sequence ENSEMBL: ENSMUSP00000025350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025350]
Predicted Effect probably damaging
Transcript: ENSMUST00000025350
AA Change: P206T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025350
Gene: ENSMUSG00000024472
AA Change: P206T

DomainStartEndE-ValueType
DCP2 10 94 4.23e-50 SMART
Pfam:NUDIX 97 219 6.5e-17 PFAM
low complexity region 240 258 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a key component of an mRNA-decapping complex required for degradation of mRNAs, both in normal mRNA turnover, and in nonsense-mediated mRNA decay (NMD). It removes the 7-methyl guanine cap structure from mRNA, prior to its degradation from the 5' end. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik G T 16: 88,759,093 R65L unknown Het
9930021J03Rik A C 19: 29,716,963 F1710C possibly damaging Het
Abcc5 A T 16: 20,338,886 M1307K probably damaging Het
Anapc1 A T 2: 128,680,434 C129* probably null Het
Brox A T 1: 183,291,988 S39R possibly damaging Het
Cd109 T C 9: 78,660,968 V310A probably benign Het
Chd9 G A 8: 91,015,925 probably null Het
Chmp2b A T 16: 65,540,430 I170N probably damaging Het
Cnp G T 11: 100,576,417 G62V probably damaging Het
Dhx57 A T 17: 80,254,379 V902E possibly damaging Het
Dmwd G A 7: 19,080,438 V338M probably damaging Het
Eva1c A G 16: 90,904,251 D258G probably benign Het
Fam71e2 A G 7: 4,758,450 V421A probably damaging Het
Flvcr2 T A 12: 85,804,407 F448L probably benign Het
Gchfr C T 2: 119,169,706 H23Y probably benign Het
Gm11397 T A 13: 33,404,318 D295E probably benign Het
Gm8251 C G 1: 44,058,515 R1141T possibly damaging Het
Helz2 T A 2: 181,230,126 M2617L probably damaging Het
Ighv5-9-1 A T 12: 113,736,125 Y122* probably null Het
Lrrtm3 A G 10: 63,930,266 I514T probably benign Het
Nolc1 GAGCAGCAGCAGCAGCAGCAGCAGCAGC GAGCAGCAGCAGCAGCAGCAGCAGC 19: 46,083,155 probably benign Het
Obox5 A T 7: 15,757,597 I21F probably benign Het
Olfr566 C T 7: 102,857,207 G25D possibly damaging Het
P2rx2 T C 5: 110,340,561 I376V possibly damaging Het
Poli A G 18: 70,509,285 S529P probably benign Het
Ruvbl1 T C 6: 88,473,096 I83T possibly damaging Het
Rwdd2a T C 9: 86,574,430 S220P probably damaging Het
Sf3b3 A T 8: 110,838,215 D320E probably benign Het
Slc6a21 C A 7: 45,288,429 L390I possibly damaging Het
Smarcd1 T G 15: 99,703,295 probably null Het
Sp1 T A 15: 102,408,930 S295T probably benign Het
Tas2r104 T A 6: 131,685,131 H205L probably damaging Het
Tmem69 C G 4: 116,553,191 G194A probably damaging Het
Unc5c G T 3: 141,803,787 C676F probably damaging Het
Unkl A G 17: 25,205,713 N52S probably benign Het
Vmn1r233 T C 17: 20,994,577 Y37C possibly damaging Het
Vmn1r57 A G 7: 5,220,899 N141S probably damaging Het
Vmn2r50 T C 7: 10,037,326 Y816C probably damaging Het
Vmn2r51 T A 7: 10,092,201 S540C probably damaging Het
Other mutations in Dcp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02801:Dcp2 APN 18 44417711 missense probably damaging 1.00
belay UTSW 18 44395952 missense probably damaging 0.99
PIT4431001:Dcp2 UTSW 18 44412571 missense probably benign 0.15
R0051:Dcp2 UTSW 18 44405374 splice site probably benign
R0515:Dcp2 UTSW 18 44399731 missense probably benign 0.41
R0761:Dcp2 UTSW 18 44410233 missense probably benign 0.01
R1696:Dcp2 UTSW 18 44400324 missense probably damaging 1.00
R1803:Dcp2 UTSW 18 44395917 missense probably damaging 1.00
R1928:Dcp2 UTSW 18 44405571 critical splice donor site probably null
R1964:Dcp2 UTSW 18 44395971 missense possibly damaging 0.50
R2014:Dcp2 UTSW 18 44410296 missense probably benign 0.00
R2209:Dcp2 UTSW 18 44405514 nonsense probably null
R4167:Dcp2 UTSW 18 44395967 missense probably damaging 1.00
R4668:Dcp2 UTSW 18 44415362 splice site probably null
R4877:Dcp2 UTSW 18 44417592 missense probably benign 0.11
R5147:Dcp2 UTSW 18 44417595 nonsense probably null
R6533:Dcp2 UTSW 18 44399664 missense probably benign 0.25
R7406:Dcp2 UTSW 18 44410187 missense probably benign 0.00
R7469:Dcp2 UTSW 18 44395952 missense probably damaging 0.99
R7850:Dcp2 UTSW 18 44400348 nonsense probably null
R7933:Dcp2 UTSW 18 44400348 nonsense probably null
R8054:Dcp2 UTSW 18 44405707 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCATTCCAGGAGTCCCAAAAG -3'
(R):5'- TCACTGTCCGAGGAATCTCC -3'

Sequencing Primer
(F):5'- GAGTCCCAAAAGACACAAAATTTAAC -3'
(R):5'- GTCCGAGGAATCTCCAAATCTTCG -3'
Posted On2016-10-24