Incidental Mutation 'R5560:Ipo9'
ID436489
Institutional Source Beutler Lab
Gene Symbol Ipo9
Ensembl Gene ENSMUSG00000041879
Gene Nameimportin 9
Synonyms
MMRRC Submission 043117-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5560 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location135382312-135430499 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 135402245 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 486 (L486F)
Ref Sequence ENSEMBL: ENSMUSP00000124779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041023] [ENSMUST00000161032] [ENSMUST00000161189] [ENSMUST00000161838]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041023
AA Change: L486F

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000036093
Gene: ENSMUSG00000041879
AA Change: L486F

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
IBN_N 43 119 3.83e-7 SMART
low complexity region 911 922 N/A INTRINSIC
low complexity region 978 990 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159017
Predicted Effect probably damaging
Transcript: ENSMUST00000161032
AA Change: L486F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124779
Gene: ENSMUSG00000041879
AA Change: L486F

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
IBN_N 43 119 3.83e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161135
Predicted Effect probably benign
Transcript: ENSMUST00000161189
SMART Domains Protein: ENSMUSP00000124492
Gene: ENSMUSG00000041879

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
SCOP:d1i6la_ 21 52 4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161704
Predicted Effect probably benign
Transcript: ENSMUST00000161838
SMART Domains Protein: ENSMUSP00000125646
Gene: ENSMUSG00000041879

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
SCOP:d1i6la_ 21 52 4e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adipor1 T C 1: 134,426,040 W188R possibly damaging Het
Agrn T C 4: 156,178,497 D441G probably damaging Het
Ankrd55 T C 13: 112,383,490 S570P probably benign Het
Ano9 C G 7: 141,110,482 G80R probably damaging Het
Arhgef2 T A 3: 88,634,437 V250E probably damaging Het
Atp2b2 T C 6: 113,774,358 D583G possibly damaging Het
Bcar3 T A 3: 122,426,575 D40E possibly damaging Het
Capn12 A G 7: 28,882,860 D133G probably benign Het
Ccna1 A T 3: 55,048,569 Y269N probably damaging Het
Cct6b A T 11: 82,741,413 Y250N probably damaging Het
Cep112 A C 11: 108,437,235 K98Q probably damaging Het
Chst13 T C 6: 90,318,269 D54G probably damaging Het
Clstn2 G T 9: 97,469,819 H518N possibly damaging Het
Cntnap1 T A 11: 101,182,435 L581M probably damaging Het
Cog3 T A 14: 75,729,393 M446L probably damaging Het
D430042O09Rik T C 7: 125,854,561 V1150A probably benign Het
Dennd2c T A 3: 103,161,555 I756K probably damaging Het
Dennd3 T G 15: 73,532,895 L273R probably damaging Het
Dhx34 C A 7: 16,218,541 R53L probably benign Het
Dnah9 G A 11: 65,881,740 T3722I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dusp6 A G 10: 99,266,241 Y217C probably damaging Het
Dyrk1b G A 7: 28,184,253 R178Q possibly damaging Het
Eif4g1 T A 16: 20,686,895 C1009S probably benign Het
Fam198a T C 9: 121,978,223 F478L possibly damaging Het
Frmpd1 A T 4: 45,243,697 T57S probably damaging Het
Gjc2 A G 11: 59,177,359 V99A possibly damaging Het
Gm9955 A T 18: 24,709,092 probably benign Het
Gpr158 A G 2: 21,826,290 I734V possibly damaging Het
Herc1 A T 9: 66,451,119 H2494L probably benign Het
Hist1h1c A G 13: 23,739,407 S187G probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmgcs1 A G 13: 119,699,815 probably null Het
Invs A T 4: 48,416,084 T655S probably benign Het
Kcnj6 A T 16: 94,832,965 L96M probably benign Het
Lfng A G 5: 140,614,267 D354G possibly damaging Het
Lgsn T C 1: 31,196,872 L139P probably damaging Het
Madd C A 2: 91,163,545 V923L probably damaging Het
Mfsd7a A T 5: 108,448,863 M1K probably null Het
Mical1 A T 10: 41,478,965 I157F probably damaging Het
Mis18bp1 T C 12: 65,152,816 N154S possibly damaging Het
Mrps14 A G 1: 160,195,535 K6R probably benign Het
Mug1 T A 6: 121,861,073 C421S probably damaging Het
Myo18b A G 5: 112,868,295 I696T probably damaging Het
Naf1 T C 8: 66,883,545 Y375H probably damaging Het
Nsf T A 11: 103,863,255 E485V possibly damaging Het
Nup188 A G 2: 30,309,885 D307G probably damaging Het
Ocel1 C A 8: 71,372,478 P108T probably damaging Het
Oip5 A G 2: 119,613,059 S177P probably damaging Het
Olfr1436 G A 19: 12,298,644 Q163* probably null Het
Olfr365 A G 2: 37,201,930 I230V probably benign Het
Olfr51 A C 11: 51,007,523 I184L possibly damaging Het
Olfr943 A C 9: 39,184,184 E2A probably benign Het
Omg A G 11: 79,501,758 W425R possibly damaging Het
Pikfyve A G 1: 65,253,407 Y1339C probably damaging Het
Polr3e A G 7: 120,922,949 D6G possibly damaging Het
Pou4f3 C A 18: 42,395,415 P141Q probably benign Het
Rcsd1 T A 1: 165,655,501 N337I possibly damaging Het
Rhoj C T 12: 75,391,712 P91S probably damaging Het
Rnf10 A G 5: 115,249,998 F367S probably damaging Het
Rnft1 A T 11: 86,493,196 R307S probably benign Het
Ryr3 A T 2: 112,754,877 F2788Y probably damaging Het
Scgb1c1 A G 7: 140,846,224 K78E possibly damaging Het
Scn5a G T 9: 119,560,286 A123E probably damaging Het
Setd2 T A 9: 110,549,839 Y623* probably null Het
Tbl2 C T 5: 135,157,591 Q216* probably null Het
Thegl A G 5: 77,016,486 D112G possibly damaging Het
Tnc A G 4: 64,008,709 I860T probably damaging Het
Trafd1 T C 5: 121,373,303 K484R possibly damaging Het
Trank1 T C 9: 111,390,567 V2124A probably damaging Het
Trpm4 A T 7: 45,310,332 W713R probably damaging Het
Uap1l1 T C 2: 25,362,676 T451A probably benign Het
Uba6 A T 5: 86,131,260 C668S probably damaging Het
Ubxn11 T C 4: 134,126,624 F441S probably damaging Het
Vmn1r22 C T 6: 57,900,738 V85M probably damaging Het
Vmn2r72 T A 7: 85,751,942 I90L probably damaging Het
Wdr60 T C 12: 116,218,113 S769G probably damaging Het
Zfp330 T C 8: 82,764,956 E196G probably benign Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp994 T C 17: 22,201,713 E85G possibly damaging Het
Other mutations in Ipo9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Ipo9 APN 1 135400059 missense probably damaging 1.00
IGL01611:Ipo9 APN 1 135386693 missense possibly damaging 0.76
IGL01941:Ipo9 APN 1 135408073 missense possibly damaging 0.95
IGL01944:Ipo9 APN 1 135405886 missense probably damaging 0.98
IGL01959:Ipo9 APN 1 135420355 critical splice acceptor site probably null
IGL02649:Ipo9 APN 1 135385934 missense possibly damaging 0.92
IGL02697:Ipo9 APN 1 135390576 missense probably benign 0.00
IGL03286:Ipo9 APN 1 135407078 intron probably benign
FR4304:Ipo9 UTSW 1 135386275 small insertion probably benign
FR4304:Ipo9 UTSW 1 135386279 nonsense probably null
FR4340:Ipo9 UTSW 1 135386269 small insertion probably benign
FR4340:Ipo9 UTSW 1 135386271 small insertion probably benign
FR4548:Ipo9 UTSW 1 135386275 small insertion probably benign
FR4589:Ipo9 UTSW 1 135386266 small insertion probably benign
FR4589:Ipo9 UTSW 1 135386281 small insertion probably benign
FR4976:Ipo9 UTSW 1 135386281 small insertion probably benign
R0111:Ipo9 UTSW 1 135405924 missense probably damaging 0.97
R0238:Ipo9 UTSW 1 135404336 splice site probably benign
R0239:Ipo9 UTSW 1 135404336 splice site probably benign
R0279:Ipo9 UTSW 1 135420363 intron probably benign
R0704:Ipo9 UTSW 1 135386268 small deletion probably benign
R1070:Ipo9 UTSW 1 135406543 missense possibly damaging 0.89
R1282:Ipo9 UTSW 1 135402292 missense possibly damaging 0.48
R1467:Ipo9 UTSW 1 135406543 missense possibly damaging 0.89
R1467:Ipo9 UTSW 1 135406543 missense possibly damaging 0.89
R1728:Ipo9 UTSW 1 135386268 small insertion probably benign
R1728:Ipo9 UTSW 1 135386271 small insertion probably benign
R1728:Ipo9 UTSW 1 135402250 missense probably benign
R1729:Ipo9 UTSW 1 135386268 small insertion probably benign
R1729:Ipo9 UTSW 1 135402250 missense probably benign
R1730:Ipo9 UTSW 1 135386268 small insertion probably benign
R1730:Ipo9 UTSW 1 135402250 missense probably benign
R1739:Ipo9 UTSW 1 135386268 small insertion probably benign
R1739:Ipo9 UTSW 1 135402250 missense probably benign
R1762:Ipo9 UTSW 1 135386268 small insertion probably benign
R1762:Ipo9 UTSW 1 135402250 missense probably benign
R1783:Ipo9 UTSW 1 135386268 small insertion probably benign
R1783:Ipo9 UTSW 1 135402250 missense probably benign
R1784:Ipo9 UTSW 1 135386268 small insertion probably benign
R1784:Ipo9 UTSW 1 135402250 missense probably benign
R1785:Ipo9 UTSW 1 135386268 small insertion probably benign
R1785:Ipo9 UTSW 1 135386281 small insertion probably benign
R1785:Ipo9 UTSW 1 135402250 missense probably benign
R1899:Ipo9 UTSW 1 135400146 missense probably damaging 0.99
R2049:Ipo9 UTSW 1 135386268 small insertion probably benign
R2049:Ipo9 UTSW 1 135402250 missense probably benign
R2130:Ipo9 UTSW 1 135386268 small insertion probably benign
R2130:Ipo9 UTSW 1 135402250 missense probably benign
R2131:Ipo9 UTSW 1 135386268 small insertion probably benign
R2131:Ipo9 UTSW 1 135402250 missense probably benign
R2133:Ipo9 UTSW 1 135386268 small insertion probably benign
R2133:Ipo9 UTSW 1 135386275 small insertion probably benign
R2133:Ipo9 UTSW 1 135402250 missense probably benign
R2136:Ipo9 UTSW 1 135394285 missense probably damaging 0.98
R2141:Ipo9 UTSW 1 135386268 small insertion probably benign
R2141:Ipo9 UTSW 1 135402250 missense probably benign
R2142:Ipo9 UTSW 1 135386268 small insertion probably benign
R2142:Ipo9 UTSW 1 135386275 small insertion probably benign
R2142:Ipo9 UTSW 1 135386282 small insertion probably benign
R2142:Ipo9 UTSW 1 135402250 missense probably benign
R2356:Ipo9 UTSW 1 135406817 missense probably benign 0.00
R2923:Ipo9 UTSW 1 135400129 missense probably benign 0.25
R3161:Ipo9 UTSW 1 135409476 missense probably benign 0.43
R3162:Ipo9 UTSW 1 135409476 missense probably benign 0.43
R3162:Ipo9 UTSW 1 135409476 missense probably benign 0.43
R4086:Ipo9 UTSW 1 135388690 unclassified probably benign
R4679:Ipo9 UTSW 1 135394169 missense probably benign
R4816:Ipo9 UTSW 1 135406550 missense probably benign 0.21
R4956:Ipo9 UTSW 1 135404222 critical splice donor site probably null
R5052:Ipo9 UTSW 1 135388611 splice site probably null
R5055:Ipo9 UTSW 1 135402359 nonsense probably null
R5230:Ipo9 UTSW 1 135420070 missense probably damaging 1.00
R5240:Ipo9 UTSW 1 135389606 unclassified probably benign
R5257:Ipo9 UTSW 1 135385435 missense probably damaging 1.00
R5340:Ipo9 UTSW 1 135385432 missense probably benign 0.00
R5602:Ipo9 UTSW 1 135402245 missense probably damaging 0.99
R5604:Ipo9 UTSW 1 135402245 missense probably damaging 0.99
R5654:Ipo9 UTSW 1 135385472 nonsense probably null
R6018:Ipo9 UTSW 1 135390536 critical splice donor site probably null
R6128:Ipo9 UTSW 1 135390573 missense possibly damaging 0.90
R6841:Ipo9 UTSW 1 135386308 missense probably benign
R7230:Ipo9 UTSW 1 135406758 critical splice donor site probably benign
R7255:Ipo9 UTSW 1 135385988 missense probably benign 0.01
R7383:Ipo9 UTSW 1 135388673 missense probably damaging 1.00
R7844:Ipo9 UTSW 1 135394324 missense probably benign 0.00
R7889:Ipo9 UTSW 1 135406853 missense probably benign 0.22
R8125:Ipo9 UTSW 1 135403340 missense probably benign 0.00
R8823:Ipo9 UTSW 1 135419339 missense probably damaging 0.99
R8889:Ipo9 UTSW 1 135386806 missense possibly damaging 0.50
R8892:Ipo9 UTSW 1 135386806 missense possibly damaging 0.50
R8906:Ipo9 UTSW 1 135394213 missense probably damaging 1.00
Y5405:Ipo9 UTSW 1 135386269 small insertion probably benign
Y5405:Ipo9 UTSW 1 135386275 small insertion probably benign
Y5405:Ipo9 UTSW 1 135386284 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CTCAAAGGACTAGGCAGGGGTA -3'
(R):5'- GAAATACTGACAAATGATTTGGGATC -3'

Sequencing Primer
(F):5'- CTAGGCAGGGGTAATATAGGATAC -3'
(R):5'- ACTTTGGAATACTCTGAGGGATC -3'
Posted On2016-10-24