Incidental Mutation 'R5560:Mrps14'
ID 436490
Institutional Source Beutler Lab
Gene Symbol Mrps14
Ensembl Gene ENSMUSG00000058267
Gene Name mitochondrial ribosomal protein S14
Synonyms 1810032L21Rik, Rpms14
MMRRC Submission 043117-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock # R5560 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 160195215-160202170 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 160195535 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 6 (K6R)
Ref Sequence ENSEMBL: ENSMUSP00000107285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078878] [ENSMUST00000097193] [ENSMUST00000135680]
AlphaFold Q9CR88
Predicted Effect probably benign
Transcript: ENSMUST00000078878
Predicted Effect probably benign
Transcript: ENSMUST00000097193
AA Change: K6R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107285
Gene: ENSMUSG00000058267
AA Change: K6R

DomainStartEndE-ValueType
Pfam:Ribosomal_S14 67 121 1.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135680
SMART Domains Protein: ENSMUSP00000120075
Gene: ENSMUSG00000058267

DomainStartEndE-ValueType
Pfam:Ribosomal_S14 74 126 1.6e-24 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S14P family. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adipor1 T C 1: 134,426,040 W188R possibly damaging Het
Agrn T C 4: 156,178,497 D441G probably damaging Het
Ankrd55 T C 13: 112,383,490 S570P probably benign Het
Ano9 C G 7: 141,110,482 G80R probably damaging Het
Arhgef2 T A 3: 88,634,437 V250E probably damaging Het
Atp2b2 T C 6: 113,774,358 D583G possibly damaging Het
Bcar3 T A 3: 122,426,575 D40E possibly damaging Het
Capn12 A G 7: 28,882,860 D133G probably benign Het
Ccna1 A T 3: 55,048,569 Y269N probably damaging Het
Cct6b A T 11: 82,741,413 Y250N probably damaging Het
Cep112 A C 11: 108,437,235 K98Q probably damaging Het
Chst13 T C 6: 90,318,269 D54G probably damaging Het
Clstn2 G T 9: 97,469,819 H518N possibly damaging Het
Cntnap1 T A 11: 101,182,435 L581M probably damaging Het
Cog3 T A 14: 75,729,393 M446L probably damaging Het
D430042O09Rik T C 7: 125,854,561 V1150A probably benign Het
Dennd2c T A 3: 103,161,555 I756K probably damaging Het
Dennd3 T G 15: 73,532,895 L273R probably damaging Het
Dhx34 C A 7: 16,218,541 R53L probably benign Het
Dnah9 G A 11: 65,881,740 T3722I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dusp6 A G 10: 99,266,241 Y217C probably damaging Het
Dyrk1b G A 7: 28,184,253 R178Q possibly damaging Het
Eif4g1 T A 16: 20,686,895 C1009S probably benign Het
Fam198a T C 9: 121,978,223 F478L possibly damaging Het
Frmpd1 A T 4: 45,243,697 T57S probably damaging Het
Gjc2 A G 11: 59,177,359 V99A possibly damaging Het
Gm9955 A T 18: 24,709,092 probably benign Het
Gpr158 A G 2: 21,826,290 I734V possibly damaging Het
Herc1 A T 9: 66,451,119 H2494L probably benign Het
Hist1h1c A G 13: 23,739,407 S187G probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmgcs1 A G 13: 119,699,815 probably null Het
Invs A T 4: 48,416,084 T655S probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Kcnj6 A T 16: 94,832,965 L96M probably benign Het
Lfng A G 5: 140,614,267 D354G possibly damaging Het
Lgsn T C 1: 31,196,872 L139P probably damaging Het
Madd C A 2: 91,163,545 V923L probably damaging Het
Mfsd7a A T 5: 108,448,863 M1K probably null Het
Mical1 A T 10: 41,478,965 I157F probably damaging Het
Mis18bp1 T C 12: 65,152,816 N154S possibly damaging Het
Mug1 T A 6: 121,861,073 C421S probably damaging Het
Myo18b A G 5: 112,868,295 I696T probably damaging Het
Naf1 T C 8: 66,883,545 Y375H probably damaging Het
Nsf T A 11: 103,863,255 E485V possibly damaging Het
Nup188 A G 2: 30,309,885 D307G probably damaging Het
Ocel1 C A 8: 71,372,478 P108T probably damaging Het
Oip5 A G 2: 119,613,059 S177P probably damaging Het
Olfr1436 G A 19: 12,298,644 Q163* probably null Het
Olfr365 A G 2: 37,201,930 I230V probably benign Het
Olfr51 A C 11: 51,007,523 I184L possibly damaging Het
Olfr943 A C 9: 39,184,184 E2A probably benign Het
Omg A G 11: 79,501,758 W425R possibly damaging Het
Pikfyve A G 1: 65,253,407 Y1339C probably damaging Het
Polr3e A G 7: 120,922,949 D6G possibly damaging Het
Pou4f3 C A 18: 42,395,415 P141Q probably benign Het
Rcsd1 T A 1: 165,655,501 N337I possibly damaging Het
Rhoj C T 12: 75,391,712 P91S probably damaging Het
Rnf10 A G 5: 115,249,998 F367S probably damaging Het
Rnft1 A T 11: 86,493,196 R307S probably benign Het
Ryr3 A T 2: 112,754,877 F2788Y probably damaging Het
Scgb1c1 A G 7: 140,846,224 K78E possibly damaging Het
Scn5a G T 9: 119,560,286 A123E probably damaging Het
Setd2 T A 9: 110,549,839 Y623* probably null Het
Tbl2 C T 5: 135,157,591 Q216* probably null Het
Thegl A G 5: 77,016,486 D112G possibly damaging Het
Tnc A G 4: 64,008,709 I860T probably damaging Het
Trafd1 T C 5: 121,373,303 K484R possibly damaging Het
Trank1 T C 9: 111,390,567 V2124A probably damaging Het
Trpm4 A T 7: 45,310,332 W713R probably damaging Het
Uap1l1 T C 2: 25,362,676 T451A probably benign Het
Uba6 A T 5: 86,131,260 C668S probably damaging Het
Ubxn11 T C 4: 134,126,624 F441S probably damaging Het
Vmn1r22 C T 6: 57,900,738 V85M probably damaging Het
Vmn2r72 T A 7: 85,751,942 I90L probably damaging Het
Wdr60 T C 12: 116,218,113 S769G probably damaging Het
Zfp330 T C 8: 82,764,956 E196G probably benign Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp994 T C 17: 22,201,713 E85G possibly damaging Het
Other mutations in Mrps14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Mrps14 APN 1 160196995 nonsense probably null
BB001:Mrps14 UTSW 1 160196989 missense probably benign 0.00
BB011:Mrps14 UTSW 1 160196989 missense probably benign 0.00
R1467:Mrps14 UTSW 1 160196950 missense probably benign 0.02
R1467:Mrps14 UTSW 1 160196950 missense probably benign 0.02
R2147:Mrps14 UTSW 1 160195292 missense possibly damaging 0.72
R7924:Mrps14 UTSW 1 160196989 missense probably benign 0.00
R9596:Mrps14 UTSW 1 160199552 missense possibly damaging 0.79
Z1176:Mrps14 UTSW 1 160197027 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGAACCTGTTTCCGGTGTTG -3'
(R):5'- TCTACAGCCAATTCTCGGCC -3'

Sequencing Primer
(F):5'- AGACAACATGGCGGCGTC -3'
(R):5'- GGCCCTTCCTTTAACTAATTCTG -3'
Posted On 2016-10-24