Incidental Mutation 'R5560:Mrps14'
ID 436490
Institutional Source Beutler Lab
Gene Symbol Mrps14
Ensembl Gene ENSMUSG00000058267
Gene Name mitochondrial ribosomal protein S14
Synonyms Rpms14, 1810032L21Rik
MMRRC Submission 043117-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.917) question?
Stock # R5560 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 160022785-160028756 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 160023105 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 6 (K6R)
Ref Sequence ENSEMBL: ENSMUSP00000107285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078878] [ENSMUST00000097193] [ENSMUST00000135680]
AlphaFold Q9CR88
Predicted Effect probably benign
Transcript: ENSMUST00000078878
Predicted Effect probably benign
Transcript: ENSMUST00000097193
AA Change: K6R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107285
Gene: ENSMUSG00000058267
AA Change: K6R

DomainStartEndE-ValueType
Pfam:Ribosomal_S14 67 121 1.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135680
SMART Domains Protein: ENSMUSP00000120075
Gene: ENSMUSG00000058267

DomainStartEndE-ValueType
Pfam:Ribosomal_S14 74 126 1.6e-24 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S14P family. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adipor1 T C 1: 134,353,778 (GRCm39) W188R possibly damaging Het
Agrn T C 4: 156,262,954 (GRCm39) D441G probably damaging Het
Ankrd55 T C 13: 112,520,024 (GRCm39) S570P probably benign Het
Ano9 C G 7: 140,690,395 (GRCm39) G80R probably damaging Het
Arhgef2 T A 3: 88,541,744 (GRCm39) V250E probably damaging Het
Atp2b2 T C 6: 113,751,319 (GRCm39) D583G possibly damaging Het
Bcar3 T A 3: 122,220,224 (GRCm39) D40E possibly damaging Het
Capn12 A G 7: 28,582,285 (GRCm39) D133G probably benign Het
Ccna1 A T 3: 54,955,990 (GRCm39) Y269N probably damaging Het
Cct6b A T 11: 82,632,239 (GRCm39) Y250N probably damaging Het
Cep112 A C 11: 108,328,061 (GRCm39) K98Q probably damaging Het
Chst13 T C 6: 90,295,251 (GRCm39) D54G probably damaging Het
Clstn2 G T 9: 97,351,872 (GRCm39) H518N possibly damaging Het
Cntnap1 T A 11: 101,073,261 (GRCm39) L581M probably damaging Het
Cog3 T A 14: 75,966,833 (GRCm39) M446L probably damaging Het
Dennd2c T A 3: 103,068,871 (GRCm39) I756K probably damaging Het
Dennd3 T G 15: 73,404,744 (GRCm39) L273R probably damaging Het
Dhx34 C A 7: 15,952,466 (GRCm39) R53L probably benign Het
Dnah9 G A 11: 65,772,566 (GRCm39) T3722I probably benign Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Dusp6 A G 10: 99,102,103 (GRCm39) Y217C probably damaging Het
Dync2i1 T C 12: 116,181,733 (GRCm39) S769G probably damaging Het
Dyrk1b G A 7: 27,883,678 (GRCm39) R178Q possibly damaging Het
Eif4g1 T A 16: 20,505,645 (GRCm39) C1009S probably benign Het
Frmpd1 A T 4: 45,243,697 (GRCm39) T57S probably damaging Het
Gask1a T C 9: 121,807,289 (GRCm39) F478L possibly damaging Het
Gjc2 A G 11: 59,068,185 (GRCm39) V99A possibly damaging Het
Gm9955 A T 18: 24,842,149 (GRCm39) probably benign Het
Gpr158 A G 2: 21,831,101 (GRCm39) I734V possibly damaging Het
H1f2 A G 13: 23,923,390 (GRCm39) S187G probably benign Het
Herc1 A T 9: 66,358,401 (GRCm39) H2494L probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmgcs1 A G 13: 120,161,351 (GRCm39) probably null Het
Invs A T 4: 48,416,084 (GRCm39) T655S probably benign Het
Ipo9 G A 1: 135,329,983 (GRCm39) L486F probably damaging Het
Katnip T C 7: 125,453,733 (GRCm39) V1150A probably benign Het
Kcnj6 A T 16: 94,633,824 (GRCm39) L96M probably benign Het
Lfng A G 5: 140,600,022 (GRCm39) D354G possibly damaging Het
Lgsn T C 1: 31,235,953 (GRCm39) L139P probably damaging Het
Madd C A 2: 90,993,890 (GRCm39) V923L probably damaging Het
Mical1 A T 10: 41,354,961 (GRCm39) I157F probably damaging Het
Mis18bp1 T C 12: 65,199,590 (GRCm39) N154S possibly damaging Het
Mug1 T A 6: 121,838,032 (GRCm39) C421S probably damaging Het
Myo18b A G 5: 113,016,161 (GRCm39) I696T probably damaging Het
Naf1 T C 8: 67,336,197 (GRCm39) Y375H probably damaging Het
Nsf T A 11: 103,754,081 (GRCm39) E485V possibly damaging Het
Nup188 A G 2: 30,199,897 (GRCm39) D307G probably damaging Het
Ocel1 C A 8: 71,825,122 (GRCm39) P108T probably damaging Het
Oip5 A G 2: 119,443,540 (GRCm39) S177P probably damaging Het
Omg A G 11: 79,392,584 (GRCm39) W425R possibly damaging Het
Or1ad8 A C 11: 50,898,350 (GRCm39) I184L possibly damaging Het
Or1l4 A G 2: 37,091,942 (GRCm39) I230V probably benign Het
Or5an10 G A 19: 12,276,008 (GRCm39) Q163* probably null Het
Or8g26 A C 9: 39,095,480 (GRCm39) E2A probably benign Het
Pikfyve A G 1: 65,292,566 (GRCm39) Y1339C probably damaging Het
Polr3e A G 7: 120,522,172 (GRCm39) D6G possibly damaging Het
Pou4f3 C A 18: 42,528,480 (GRCm39) P141Q probably benign Het
Rcsd1 T A 1: 165,483,070 (GRCm39) N337I possibly damaging Het
Rhoj C T 12: 75,438,486 (GRCm39) P91S probably damaging Het
Rnf10 A G 5: 115,388,057 (GRCm39) F367S probably damaging Het
Rnft1 A T 11: 86,384,022 (GRCm39) R307S probably benign Het
Ryr3 A T 2: 112,585,222 (GRCm39) F2788Y probably damaging Het
Scgb1c1 A G 7: 140,426,137 (GRCm39) K78E possibly damaging Het
Scn5a G T 9: 119,389,352 (GRCm39) A123E probably damaging Het
Setd2 T A 9: 110,378,907 (GRCm39) Y623* probably null Het
Slc49a3 A T 5: 108,596,729 (GRCm39) M1K probably null Het
Spmap2l A G 5: 77,164,333 (GRCm39) D112G possibly damaging Het
Tbl2 C T 5: 135,186,445 (GRCm39) Q216* probably null Het
Tnc A G 4: 63,926,946 (GRCm39) I860T probably damaging Het
Trafd1 T C 5: 121,511,366 (GRCm39) K484R possibly damaging Het
Trank1 T C 9: 111,219,635 (GRCm39) V2124A probably damaging Het
Trpm4 A T 7: 44,959,756 (GRCm39) W713R probably damaging Het
Uap1l1 T C 2: 25,252,688 (GRCm39) T451A probably benign Het
Uba6 A T 5: 86,279,119 (GRCm39) C668S probably damaging Het
Ubxn11 T C 4: 133,853,935 (GRCm39) F441S probably damaging Het
Vmn1r22 C T 6: 57,877,723 (GRCm39) V85M probably damaging Het
Vmn2r72 T A 7: 85,401,150 (GRCm39) I90L probably damaging Het
Zfp330 T C 8: 83,491,585 (GRCm39) E196G probably benign Het
Zfp746 A G 6: 48,059,108 (GRCm39) V167A possibly damaging Het
Zfp994 T C 17: 22,420,694 (GRCm39) E85G possibly damaging Het
Other mutations in Mrps14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Mrps14 APN 1 160,024,565 (GRCm39) nonsense probably null
BB001:Mrps14 UTSW 1 160,024,559 (GRCm39) missense probably benign 0.00
BB011:Mrps14 UTSW 1 160,024,559 (GRCm39) missense probably benign 0.00
R1467:Mrps14 UTSW 1 160,024,520 (GRCm39) missense probably benign 0.02
R1467:Mrps14 UTSW 1 160,024,520 (GRCm39) missense probably benign 0.02
R2147:Mrps14 UTSW 1 160,022,862 (GRCm39) missense possibly damaging 0.72
R7924:Mrps14 UTSW 1 160,024,559 (GRCm39) missense probably benign 0.00
R9596:Mrps14 UTSW 1 160,027,122 (GRCm39) missense possibly damaging 0.79
Z1176:Mrps14 UTSW 1 160,024,597 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGAACCTGTTTCCGGTGTTG -3'
(R):5'- TCTACAGCCAATTCTCGGCC -3'

Sequencing Primer
(F):5'- AGACAACATGGCGGCGTC -3'
(R):5'- GGCCCTTCCTTTAACTAATTCTG -3'
Posted On 2016-10-24