Incidental Mutation 'R5560:Nup188'
ID 436494
Institutional Source Beutler Lab
Gene Symbol Nup188
Ensembl Gene ENSMUSG00000052533
Gene Name nucleoporin 188
Synonyms
MMRRC Submission 043117-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R5560 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 30176419-30234278 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30199897 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 307 (D307G)
Ref Sequence ENSEMBL: ENSMUSP00000065836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064447] [ENSMUST00000148969]
AlphaFold Q6ZQH8
Predicted Effect probably damaging
Transcript: ENSMUST00000064447
AA Change: D307G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065836
Gene: ENSMUSG00000052533
AA Change: D307G

DomainStartEndE-ValueType
Pfam:Nup188 31 941 9.3e-213 PFAM
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1307 1320 N/A INTRINSIC
low complexity region 1330 1360 N/A INTRINSIC
low complexity region 1696 1709 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141035
Predicted Effect probably benign
Transcript: ENSMUST00000148969
SMART Domains Protein: ENSMUSP00000121742
Gene: ENSMUSG00000052533

DomainStartEndE-ValueType
Pfam:Nup188 27 115 1.1e-27 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex (NPC) is found on the nuclear envelope and forms a gateway that regulates the flow of proteins and RNAs between the cytoplasm and nucleoplasm. The NPC is comprised of approximately 30 distinct proteins collectively known as nucleoporins. Nucleoporins are pore-complex-specific glycoproteins which often have cytoplasmically oriented O-linked N-acetylglucosamine residues and numerous repeats of the pentapeptide sequence XFXFG. However, the nucleoporin protein encoded by this gene does not contain the typical FG repeat sequences found in most vertebrate nucleoporins. This nucleoporin is thought to form part of the scaffold for the central channel of the nuclear pore. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adipor1 T C 1: 134,353,778 (GRCm39) W188R possibly damaging Het
Agrn T C 4: 156,262,954 (GRCm39) D441G probably damaging Het
Ankrd55 T C 13: 112,520,024 (GRCm39) S570P probably benign Het
Ano9 C G 7: 140,690,395 (GRCm39) G80R probably damaging Het
Arhgef2 T A 3: 88,541,744 (GRCm39) V250E probably damaging Het
Atp2b2 T C 6: 113,751,319 (GRCm39) D583G possibly damaging Het
Bcar3 T A 3: 122,220,224 (GRCm39) D40E possibly damaging Het
Capn12 A G 7: 28,582,285 (GRCm39) D133G probably benign Het
Ccna1 A T 3: 54,955,990 (GRCm39) Y269N probably damaging Het
Cct6b A T 11: 82,632,239 (GRCm39) Y250N probably damaging Het
Cep112 A C 11: 108,328,061 (GRCm39) K98Q probably damaging Het
Chst13 T C 6: 90,295,251 (GRCm39) D54G probably damaging Het
Clstn2 G T 9: 97,351,872 (GRCm39) H518N possibly damaging Het
Cntnap1 T A 11: 101,073,261 (GRCm39) L581M probably damaging Het
Cog3 T A 14: 75,966,833 (GRCm39) M446L probably damaging Het
Dennd2c T A 3: 103,068,871 (GRCm39) I756K probably damaging Het
Dennd3 T G 15: 73,404,744 (GRCm39) L273R probably damaging Het
Dhx34 C A 7: 15,952,466 (GRCm39) R53L probably benign Het
Dnah9 G A 11: 65,772,566 (GRCm39) T3722I probably benign Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Dusp6 A G 10: 99,102,103 (GRCm39) Y217C probably damaging Het
Dync2i1 T C 12: 116,181,733 (GRCm39) S769G probably damaging Het
Dyrk1b G A 7: 27,883,678 (GRCm39) R178Q possibly damaging Het
Eif4g1 T A 16: 20,505,645 (GRCm39) C1009S probably benign Het
Frmpd1 A T 4: 45,243,697 (GRCm39) T57S probably damaging Het
Gask1a T C 9: 121,807,289 (GRCm39) F478L possibly damaging Het
Gjc2 A G 11: 59,068,185 (GRCm39) V99A possibly damaging Het
Gm9955 A T 18: 24,842,149 (GRCm39) probably benign Het
Gpr158 A G 2: 21,831,101 (GRCm39) I734V possibly damaging Het
H1f2 A G 13: 23,923,390 (GRCm39) S187G probably benign Het
Herc1 A T 9: 66,358,401 (GRCm39) H2494L probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmgcs1 A G 13: 120,161,351 (GRCm39) probably null Het
Invs A T 4: 48,416,084 (GRCm39) T655S probably benign Het
Ipo9 G A 1: 135,329,983 (GRCm39) L486F probably damaging Het
Katnip T C 7: 125,453,733 (GRCm39) V1150A probably benign Het
Kcnj6 A T 16: 94,633,824 (GRCm39) L96M probably benign Het
Lfng A G 5: 140,600,022 (GRCm39) D354G possibly damaging Het
Lgsn T C 1: 31,235,953 (GRCm39) L139P probably damaging Het
Madd C A 2: 90,993,890 (GRCm39) V923L probably damaging Het
Mical1 A T 10: 41,354,961 (GRCm39) I157F probably damaging Het
Mis18bp1 T C 12: 65,199,590 (GRCm39) N154S possibly damaging Het
Mrps14 A G 1: 160,023,105 (GRCm39) K6R probably benign Het
Mug1 T A 6: 121,838,032 (GRCm39) C421S probably damaging Het
Myo18b A G 5: 113,016,161 (GRCm39) I696T probably damaging Het
Naf1 T C 8: 67,336,197 (GRCm39) Y375H probably damaging Het
Nsf T A 11: 103,754,081 (GRCm39) E485V possibly damaging Het
Ocel1 C A 8: 71,825,122 (GRCm39) P108T probably damaging Het
Oip5 A G 2: 119,443,540 (GRCm39) S177P probably damaging Het
Omg A G 11: 79,392,584 (GRCm39) W425R possibly damaging Het
Or1ad8 A C 11: 50,898,350 (GRCm39) I184L possibly damaging Het
Or1l4 A G 2: 37,091,942 (GRCm39) I230V probably benign Het
Or5an10 G A 19: 12,276,008 (GRCm39) Q163* probably null Het
Or8g26 A C 9: 39,095,480 (GRCm39) E2A probably benign Het
Pikfyve A G 1: 65,292,566 (GRCm39) Y1339C probably damaging Het
Polr3e A G 7: 120,522,172 (GRCm39) D6G possibly damaging Het
Pou4f3 C A 18: 42,528,480 (GRCm39) P141Q probably benign Het
Rcsd1 T A 1: 165,483,070 (GRCm39) N337I possibly damaging Het
Rhoj C T 12: 75,438,486 (GRCm39) P91S probably damaging Het
Rnf10 A G 5: 115,388,057 (GRCm39) F367S probably damaging Het
Rnft1 A T 11: 86,384,022 (GRCm39) R307S probably benign Het
Ryr3 A T 2: 112,585,222 (GRCm39) F2788Y probably damaging Het
Scgb1c1 A G 7: 140,426,137 (GRCm39) K78E possibly damaging Het
Scn5a G T 9: 119,389,352 (GRCm39) A123E probably damaging Het
Setd2 T A 9: 110,378,907 (GRCm39) Y623* probably null Het
Slc49a3 A T 5: 108,596,729 (GRCm39) M1K probably null Het
Spmap2l A G 5: 77,164,333 (GRCm39) D112G possibly damaging Het
Tbl2 C T 5: 135,186,445 (GRCm39) Q216* probably null Het
Tnc A G 4: 63,926,946 (GRCm39) I860T probably damaging Het
Trafd1 T C 5: 121,511,366 (GRCm39) K484R possibly damaging Het
Trank1 T C 9: 111,219,635 (GRCm39) V2124A probably damaging Het
Trpm4 A T 7: 44,959,756 (GRCm39) W713R probably damaging Het
Uap1l1 T C 2: 25,252,688 (GRCm39) T451A probably benign Het
Uba6 A T 5: 86,279,119 (GRCm39) C668S probably damaging Het
Ubxn11 T C 4: 133,853,935 (GRCm39) F441S probably damaging Het
Vmn1r22 C T 6: 57,877,723 (GRCm39) V85M probably damaging Het
Vmn2r72 T A 7: 85,401,150 (GRCm39) I90L probably damaging Het
Zfp330 T C 8: 83,491,585 (GRCm39) E196G probably benign Het
Zfp746 A G 6: 48,059,108 (GRCm39) V167A possibly damaging Het
Zfp994 T C 17: 22,420,694 (GRCm39) E85G possibly damaging Het
Other mutations in Nup188
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Nup188 APN 2 30,223,412 (GRCm39) missense probably damaging 0.98
IGL01599:Nup188 APN 2 30,217,537 (GRCm39) missense possibly damaging 0.92
IGL01938:Nup188 APN 2 30,219,371 (GRCm39) missense probably benign
IGL01973:Nup188 APN 2 30,229,862 (GRCm39) missense possibly damaging 0.95
IGL02157:Nup188 APN 2 30,219,385 (GRCm39) nonsense probably null
IGL02221:Nup188 APN 2 30,220,653 (GRCm39) missense possibly damaging 0.75
IGL02277:Nup188 APN 2 30,216,523 (GRCm39) missense possibly damaging 0.95
IGL02335:Nup188 APN 2 30,213,648 (GRCm39) critical splice donor site probably null
IGL02986:Nup188 APN 2 30,197,645 (GRCm39) splice site probably null
IGL03029:Nup188 APN 2 30,212,592 (GRCm39) splice site probably benign
IGL03194:Nup188 APN 2 30,194,346 (GRCm39) missense possibly damaging 0.95
IGL03370:Nup188 APN 2 30,230,653 (GRCm39) missense possibly damaging 0.52
core UTSW 2 30,229,906 (GRCm39) missense probably damaging 1.00
kern UTSW 2 30,227,045 (GRCm39) missense possibly damaging 0.94
P0027:Nup188 UTSW 2 30,212,693 (GRCm39) missense probably damaging 0.99
R0006:Nup188 UTSW 2 30,212,035 (GRCm39) missense probably benign 0.27
R0360:Nup188 UTSW 2 30,216,491 (GRCm39) missense probably null 0.93
R0373:Nup188 UTSW 2 30,221,000 (GRCm39) missense probably damaging 1.00
R0645:Nup188 UTSW 2 30,233,478 (GRCm39) splice site probably null
R1411:Nup188 UTSW 2 30,233,807 (GRCm39) missense probably benign 0.01
R1670:Nup188 UTSW 2 30,230,667 (GRCm39) missense probably benign 0.19
R2034:Nup188 UTSW 2 30,200,097 (GRCm39) unclassified probably benign
R2113:Nup188 UTSW 2 30,194,113 (GRCm39) nonsense probably null
R2142:Nup188 UTSW 2 30,226,718 (GRCm39) missense possibly damaging 0.49
R2221:Nup188 UTSW 2 30,226,936 (GRCm39) splice site probably benign
R2567:Nup188 UTSW 2 30,231,794 (GRCm39) missense possibly damaging 0.53
R2964:Nup188 UTSW 2 30,215,358 (GRCm39) missense probably damaging 0.98
R4006:Nup188 UTSW 2 30,199,890 (GRCm39) missense probably damaging 0.99
R4007:Nup188 UTSW 2 30,199,890 (GRCm39) missense probably damaging 0.99
R4079:Nup188 UTSW 2 30,199,890 (GRCm39) missense probably damaging 0.99
R4480:Nup188 UTSW 2 30,212,141 (GRCm39) intron probably benign
R4628:Nup188 UTSW 2 30,219,358 (GRCm39) missense probably damaging 1.00
R4687:Nup188 UTSW 2 30,220,645 (GRCm39) missense probably benign 0.01
R4814:Nup188 UTSW 2 30,216,523 (GRCm39) missense possibly damaging 0.95
R4834:Nup188 UTSW 2 30,229,596 (GRCm39) missense probably damaging 1.00
R5038:Nup188 UTSW 2 30,199,232 (GRCm39) missense probably damaging 0.98
R5056:Nup188 UTSW 2 30,194,143 (GRCm39) missense probably damaging 0.98
R5124:Nup188 UTSW 2 30,220,947 (GRCm39) missense probably damaging 1.00
R5256:Nup188 UTSW 2 30,220,761 (GRCm39) missense probably damaging 1.00
R5284:Nup188 UTSW 2 30,220,647 (GRCm39) missense probably damaging 1.00
R5548:Nup188 UTSW 2 30,216,505 (GRCm39) missense probably damaging 0.99
R5668:Nup188 UTSW 2 30,226,336 (GRCm39) missense probably damaging 1.00
R5769:Nup188 UTSW 2 30,220,747 (GRCm39) missense probably benign 0.34
R5773:Nup188 UTSW 2 30,212,208 (GRCm39) missense possibly damaging 0.92
R5774:Nup188 UTSW 2 30,191,060 (GRCm39) missense probably damaging 1.00
R5827:Nup188 UTSW 2 30,229,859 (GRCm39) missense probably damaging 1.00
R5919:Nup188 UTSW 2 30,229,906 (GRCm39) missense probably damaging 1.00
R5923:Nup188 UTSW 2 30,194,102 (GRCm39) missense probably benign
R6185:Nup188 UTSW 2 30,231,722 (GRCm39) missense probably damaging 0.97
R6457:Nup188 UTSW 2 30,212,199 (GRCm39) missense probably damaging 0.98
R6529:Nup188 UTSW 2 30,216,466 (GRCm39) missense possibly damaging 0.95
R7002:Nup188 UTSW 2 30,213,580 (GRCm39) missense probably damaging 0.99
R7195:Nup188 UTSW 2 30,231,842 (GRCm39) critical splice donor site probably null
R7214:Nup188 UTSW 2 30,197,566 (GRCm39) missense possibly damaging 0.71
R7345:Nup188 UTSW 2 30,230,613 (GRCm39) missense probably benign 0.09
R7853:Nup188 UTSW 2 30,213,575 (GRCm39) missense possibly damaging 0.95
R7998:Nup188 UTSW 2 30,220,983 (GRCm39) missense probably damaging 1.00
R8012:Nup188 UTSW 2 30,227,277 (GRCm39) missense possibly damaging 0.95
R8080:Nup188 UTSW 2 30,227,045 (GRCm39) missense possibly damaging 0.94
R8804:Nup188 UTSW 2 30,220,891 (GRCm39) missense probably benign
R8850:Nup188 UTSW 2 30,217,576 (GRCm39) missense probably damaging 0.99
R9110:Nup188 UTSW 2 30,222,461 (GRCm39) missense possibly damaging 0.94
R9157:Nup188 UTSW 2 30,188,456 (GRCm39) missense probably benign 0.02
R9209:Nup188 UTSW 2 30,232,397 (GRCm39) missense probably benign 0.02
R9287:Nup188 UTSW 2 30,226,726 (GRCm39) missense probably damaging 0.99
R9325:Nup188 UTSW 2 30,212,271 (GRCm39) missense probably damaging 0.99
R9390:Nup188 UTSW 2 30,220,777 (GRCm39) critical splice donor site probably null
R9607:Nup188 UTSW 2 30,197,724 (GRCm39) missense probably benign 0.01
R9746:Nup188 UTSW 2 30,194,300 (GRCm39) missense probably damaging 0.99
R9768:Nup188 UTSW 2 30,227,045 (GRCm39) missense probably damaging 0.99
T0722:Nup188 UTSW 2 30,212,693 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGTGTTGGGTTCCTAGCAAG -3'
(R):5'- TTGCCGTCATGCCAACTACC -3'

Sequencing Primer
(F):5'- TCCTAGCAAGGTGGTCGAG -3'
(R):5'- ACATCATTTCCTCCACTGGCAAG -3'
Posted On 2016-10-24