Mutagenetix > Incidental Mutation

Incidental Mutation 'R5560:Invs'

436505

Institutional Source

Beutler Lab

Gene Symbol

Invs

Ensembl Gene

ENSMUSG00000028344

Gene Name

inversin

Synonyms

MMRRC Submission

043117-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.738) question?

Stock #

R5560 (G1)

Quality Score

186

Status

Not validated

Chromosome

Chromosomal Location

48279760-48431954 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 48416084 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 655 (T655S)

Ref Sequence

ENSEMBL: ENSMUSP00000030029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030029] [ENSMUST00000143433]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000030029
AA Change: T655S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000030029
Gene: ENSMUSG00000028344
AA Change: T655S

Domain	Start	End	E-Value	Type
ANK	47	76	2.66e-5	SMART
ANK	80	110	1.8e-2	SMART
ANK	113	144	1.63e0	SMART
ANK	148	177	6.46e-4	SMART
ANK	181	215	3.44e1	SMART
ANK	220	250	1.11e-2	SMART
ANK	254	285	2.07e-2	SMART
ANK	288	317	3.18e-3	SMART
ANK	321	350	3.91e-3	SMART
ANK	356	385	2.28e-4	SMART
ANK	389	418	8.39e-3	SMART
ANK	422	451	3.76e-5	SMART
ANK	455	484	2.45e-4	SMART
ANK	488	517	1.31e-4	SMART
ANK	523	553	6.71e-2	SMART
IQ	554	576	5.75e-2	SMART
low complexity region	589	607	N/A	INTRINSIC
IQ	913	935	2.46e-1	SMART
low complexity region	973	989	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000143433

SMART Domains

Protein: ENSMUSP00000138580
Gene: ENSMUSG00000028344

Domain	Start	End	E-Value	Type
ANK	47	76	2.66e-5	SMART
ANK	80	110	1.8e-2	SMART
ANK	113	144	1.63e0	SMART
ANK	164	194	1.11e-2	SMART
ANK	198	229	2.07e-2	SMART
ANK	232	261	3.18e-3	SMART
ANK	265	294	3.91e-3	SMART
ANK	300	329	2.28e-4	SMART
ANK	333	362	8.39e-3	SMART
ANK	366	395	3.76e-5	SMART
ANK	399	428	2.45e-4	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.7%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Transgenic mice homozygous for an insertional mutation exhibit complete inversion of the L-R body axis, reversal of embryo turning, complex cardiac anomalies, an abnormally slow turbulent leftward nodal flow, and renal cyst formation. Most succumb to renal failure within 1 week of life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adipor1	T	C	1: 134,426,040	W188R	possibly damaging	Het
Agrn	T	C	4: 156,178,497	D441G	probably damaging	Het
Ankrd55	T	C	13: 112,383,490	S570P	probably benign	Het
Ano9	C	G	7: 141,110,482	G80R	probably damaging	Het
Arhgef2	T	A	3: 88,634,437	V250E	probably damaging	Het
Atp2b2	T	C	6: 113,774,358	D583G	possibly damaging	Het
Bcar3	T	A	3: 122,426,575	D40E	possibly damaging	Het
Capn12	A	G	7: 28,882,860	D133G	probably benign	Het
Ccna1	A	T	3: 55,048,569	Y269N	probably damaging	Het
Cct6b	A	T	11: 82,741,413	Y250N	probably damaging	Het
Cep112	A	C	11: 108,437,235	K98Q	probably damaging	Het
Chst13	T	C	6: 90,318,269	D54G	probably damaging	Het
Clstn2	G	T	9: 97,469,819	H518N	possibly damaging	Het
Cntnap1	T	A	11: 101,182,435	L581M	probably damaging	Het
Cog3	T	A	14: 75,729,393	M446L	probably damaging	Het
D430042O09Rik	T	C	7: 125,854,561	V1150A	probably benign	Het
Dennd2c	T	A	3: 103,161,555	I756K	probably damaging	Het
Dennd3	T	G	15: 73,532,895	L273R	probably damaging	Het
Dhx34	C	A	7: 16,218,541	R53L	probably benign	Het
Dnah9	G	A	11: 65,881,740	T3722I	probably benign	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
Dusp6	A	G	10: 99,266,241	Y217C	probably damaging	Het
Dyrk1b	G	A	7: 28,184,253	R178Q	possibly damaging	Het
Eif4g1	T	A	16: 20,686,895	C1009S	probably benign	Het
Fam198a	T	C	9: 121,978,223	F478L	possibly damaging	Het
Frmpd1	A	T	4: 45,243,697	T57S	probably damaging	Het
Gjc2	A	G	11: 59,177,359	V99A	possibly damaging	Het
Gm9955	A	T	18: 24,709,092		probably benign	Het
Gpr158	A	G	2: 21,826,290	I734V	possibly damaging	Het
Herc1	A	T	9: 66,451,119	H2494L	probably benign	Het
Hist1h1c	A	G	13: 23,739,407	S187G	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hmgcs1	A	G	13: 119,699,815		probably null	Het
Ipo9	G	A	1: 135,402,245	L486F	probably damaging	Het
Kcnj6	A	T	16: 94,832,965	L96M	probably benign	Het
Lfng	A	G	5: 140,614,267	D354G	possibly damaging	Het
Lgsn	T	C	1: 31,196,872	L139P	probably damaging	Het
Madd	C	A	2: 91,163,545	V923L	probably damaging	Het
Mfsd7a	A	T	5: 108,448,863	M1K	probably null	Het
Mical1	A	T	10: 41,478,965	I157F	probably damaging	Het
Mis18bp1	T	C	12: 65,152,816	N154S	possibly damaging	Het
Mrps14	A	G	1: 160,195,535	K6R	probably benign	Het
Mug1	T	A	6: 121,861,073	C421S	probably damaging	Het
Myo18b	A	G	5: 112,868,295	I696T	probably damaging	Het
Naf1	T	C	8: 66,883,545	Y375H	probably damaging	Het
Nsf	T	A	11: 103,863,255	E485V	possibly damaging	Het
Nup188	A	G	2: 30,309,885	D307G	probably damaging	Het
Ocel1	C	A	8: 71,372,478	P108T	probably damaging	Het
Oip5	A	G	2: 119,613,059	S177P	probably damaging	Het
Olfr1436	G	A	19: 12,298,644	Q163*	probably null	Het
Olfr365	A	G	2: 37,201,930	I230V	probably benign	Het
Olfr51	A	C	11: 51,007,523	I184L	possibly damaging	Het
Olfr943	A	C	9: 39,184,184	E2A	probably benign	Het
Omg	A	G	11: 79,501,758	W425R	possibly damaging	Het
Pikfyve	A	G	1: 65,253,407	Y1339C	probably damaging	Het
Polr3e	A	G	7: 120,922,949	D6G	possibly damaging	Het
Pou4f3	C	A	18: 42,395,415	P141Q	probably benign	Het
Rcsd1	T	A	1: 165,655,501	N337I	possibly damaging	Het
Rhoj	C	T	12: 75,391,712	P91S	probably damaging	Het
Rnf10	A	G	5: 115,249,998	F367S	probably damaging	Het
Rnft1	A	T	11: 86,493,196	R307S	probably benign	Het
Ryr3	A	T	2: 112,754,877	F2788Y	probably damaging	Het
Scgb1c1	A	G	7: 140,846,224	K78E	possibly damaging	Het
Scn5a	G	T	9: 119,560,286	A123E	probably damaging	Het
Setd2	T	A	9: 110,549,839	Y623*	probably null	Het
Tbl2	C	T	5: 135,157,591	Q216*	probably null	Het
Thegl	A	G	5: 77,016,486	D112G	possibly damaging	Het
Tnc	A	G	4: 64,008,709	I860T	probably damaging	Het
Trafd1	T	C	5: 121,373,303	K484R	possibly damaging	Het
Trank1	T	C	9: 111,390,567	V2124A	probably damaging	Het
Trpm4	A	T	7: 45,310,332	W713R	probably damaging	Het
Uap1l1	T	C	2: 25,362,676	T451A	probably benign	Het
Uba6	A	T	5: 86,131,260	C668S	probably damaging	Het
Ubxn11	T	C	4: 134,126,624	F441S	probably damaging	Het
Vmn1r22	C	T	6: 57,900,738	V85M	probably damaging	Het
Vmn2r72	T	A	7: 85,751,942	I90L	probably damaging	Het
Wdr60	T	C	12: 116,218,113	S769G	probably damaging	Het
Zfp330	T	C	8: 82,764,956	E196G	probably benign	Het
Zfp746	A	G	6: 48,082,174	V167A	possibly damaging	Het
Zfp994	T	C	17: 22,201,713	E85G	possibly damaging	Het

Other mutations in Invs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Invs	APN	4	48402909	missense	probably damaging	0.98
IGL00487:Invs	APN	4	48407689	nonsense	probably null
IGL01487:Invs	APN	4	48398136	missense	probably benign	0.26
IGL01696:Invs	APN	4	48425997	missense	probably damaging	1.00
IGL02238:Invs	APN	4	48390029	missense	probably damaging	1.00
IGL03286:Invs	APN	4	48382261	missense	probably benign	0.26
R0645:Invs	UTSW	4	48407653	missense	probably benign	0.00
R0661:Invs	UTSW	4	48421861	missense	probably benign
R0698:Invs	UTSW	4	48396364	missense	probably benign	0.04
R0763:Invs	UTSW	4	48392628	missense	possibly damaging	0.82
R1183:Invs	UTSW	4	48421725	missense	possibly damaging	0.68
R1381:Invs	UTSW	4	48421942	nonsense	probably null
R1511:Invs	UTSW	4	48382148	missense	possibly damaging	0.82
R1843:Invs	UTSW	4	48422035	missense	probably damaging	0.96
R1903:Invs	UTSW	4	48402824	splice site	probably null
R1928:Invs	UTSW	4	48390095	missense	probably damaging	1.00
R1990:Invs	UTSW	4	48392599	missense	possibly damaging	0.88
R2063:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R2064:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R2065:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R2066:Invs	UTSW	4	48396287	missense	probably damaging	1.00
R4744:Invs	UTSW	4	48397609	missense	probably damaging	1.00
R4997:Invs	UTSW	4	48396332	missense	probably damaging	0.98
R5011:Invs	UTSW	4	48421807	missense	probably damaging	1.00
R5013:Invs	UTSW	4	48421807	missense	probably damaging	1.00
R5083:Invs	UTSW	4	48396307	missense	possibly damaging	0.90
R5184:Invs	UTSW	4	48283242	utr 5 prime	probably benign
R5258:Invs	UTSW	4	48396374	missense	possibly damaging	0.82
R5375:Invs	UTSW	4	48385262	missense	probably benign	0.12
R5509:Invs	UTSW	4	48396337	missense	probably damaging	1.00
R5748:Invs	UTSW	4	48307823	missense	probably damaging	0.98
R5813:Invs	UTSW	4	48398146	missense	probably damaging	0.98
R5840:Invs	UTSW	4	48396284	missense	probably damaging	1.00
R5984:Invs	UTSW	4	48421674	missense	probably benign	0.00
R6513:Invs	UTSW	4	48397534	missense	possibly damaging	0.46
R6637:Invs	UTSW	4	48416203	splice site	probably null
R6667:Invs	UTSW	4	48402870	missense	possibly damaging	0.66
R6838:Invs	UTSW	4	48283278	missense	possibly damaging	0.95
R6921:Invs	UTSW	4	48396260	missense	possibly damaging	0.46
R6945:Invs	UTSW	4	48421785	missense	probably benign	0.00
R7102:Invs	UTSW	4	48407674	missense	probably benign	0.21
R7142:Invs	UTSW	4	48407696	missense	probably damaging	1.00
R7263:Invs	UTSW	4	48396381	missense	probably damaging	1.00
R7283:Invs	UTSW	4	48392526	splice site	probably null
R7461:Invs	UTSW	4	48392668	missense	probably damaging	1.00
R7503:Invs	UTSW	4	48396347	missense	probably damaging	0.96
R7581:Invs	UTSW	4	48421909	missense	probably benign	0.00
R7613:Invs	UTSW	4	48392668	missense	probably damaging	1.00
R7861:Invs	UTSW	4	48397559	missense	possibly damaging	0.50
R8316:Invs	UTSW	4	48426199	missense	possibly damaging	0.68
R8321:Invs	UTSW	4	48283267	missense	probably benign	0.13
R8500:Invs	UTSW	4	48422109	missense	probably damaging	1.00
R8544:Invs	UTSW	4	48397598	missense	probably damaging	0.96
R9171:Invs	UTSW	4	48398149	missense	possibly damaging	0.90
R9663:Invs	UTSW	4	48426218	missense	probably damaging	1.00
X0026:Invs	UTSW	4	48398221	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TGATGATTCTCAAGCAAATGAGGC -3'
(R):5'- TGTAATAACTGCCAGCCCAC -3'

Sequencing Primer
(F):5'- CTTTGGCTTTGTTTCCAGAAAAC -3'
(R):5'- ACGGGCTGTCGTCAGAGAG -3'

Posted On

2016-10-24