Incidental Mutation 'R5560:Tnc'
ID 436506
Institutional Source Beutler Lab
Gene Symbol Tnc
Ensembl Gene ENSMUSG00000028364
Gene Name tenascin C
Synonyms cytotactin, C130033P17Rik, TN-C, hexabrachion, tenascin-C, Hxb, TN
MMRRC Submission 043117-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5560 (G1)
Quality Score 210
Status Not validated
Chromosome 4
Chromosomal Location 63878022-63965252 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63926946 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 860 (I860T)
Ref Sequence ENSEMBL: ENSMUSP00000103000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030056] [ENSMUST00000107371] [ENSMUST00000107372] [ENSMUST00000107377]
AlphaFold Q80YX1
Predicted Effect probably damaging
Transcript: ENSMUST00000030056
AA Change: I860T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030056
Gene: ENSMUSG00000028364
AA Change: I860T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107371
SMART Domains Protein: ENSMUSP00000102994
Gene: ENSMUSG00000028364

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
Pfam:hEGF 173 185 4e-4 PFAM
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107372
AA Change: I860T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000102995
Gene: ENSMUSG00000028364
AA Change: I860T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 2.75e0 SMART
FN3 1529 1608 3.4e-4 SMART
FN3 1619 1697 1.55e-7 SMART
FN3 1708 1785 1.53e-6 SMART
FN3 1796 1873 7.75e-8 SMART
FBG 1888 2098 4.08e-124 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107377
AA Change: I860T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103000
Gene: ENSMUSG00000028364
AA Change: I860T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141428
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for several different targeted mutations show variable behavioral and nervous system phenotypes such as abnormal circadian rhythm, anxiety behavior, novelty-induced activity, swimming, impaired synaptic plasticity, long term potentiation and serotonin and dopamine neurotransmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adipor1 T C 1: 134,353,778 (GRCm39) W188R possibly damaging Het
Agrn T C 4: 156,262,954 (GRCm39) D441G probably damaging Het
Ankrd55 T C 13: 112,520,024 (GRCm39) S570P probably benign Het
Ano9 C G 7: 140,690,395 (GRCm39) G80R probably damaging Het
Arhgef2 T A 3: 88,541,744 (GRCm39) V250E probably damaging Het
Atp2b2 T C 6: 113,751,319 (GRCm39) D583G possibly damaging Het
Bcar3 T A 3: 122,220,224 (GRCm39) D40E possibly damaging Het
Capn12 A G 7: 28,582,285 (GRCm39) D133G probably benign Het
Ccna1 A T 3: 54,955,990 (GRCm39) Y269N probably damaging Het
Cct6b A T 11: 82,632,239 (GRCm39) Y250N probably damaging Het
Cep112 A C 11: 108,328,061 (GRCm39) K98Q probably damaging Het
Chst13 T C 6: 90,295,251 (GRCm39) D54G probably damaging Het
Clstn2 G T 9: 97,351,872 (GRCm39) H518N possibly damaging Het
Cntnap1 T A 11: 101,073,261 (GRCm39) L581M probably damaging Het
Cog3 T A 14: 75,966,833 (GRCm39) M446L probably damaging Het
Dennd2c T A 3: 103,068,871 (GRCm39) I756K probably damaging Het
Dennd3 T G 15: 73,404,744 (GRCm39) L273R probably damaging Het
Dhx34 C A 7: 15,952,466 (GRCm39) R53L probably benign Het
Dnah9 G A 11: 65,772,566 (GRCm39) T3722I probably benign Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Dusp6 A G 10: 99,102,103 (GRCm39) Y217C probably damaging Het
Dync2i1 T C 12: 116,181,733 (GRCm39) S769G probably damaging Het
Dyrk1b G A 7: 27,883,678 (GRCm39) R178Q possibly damaging Het
Eif4g1 T A 16: 20,505,645 (GRCm39) C1009S probably benign Het
Frmpd1 A T 4: 45,243,697 (GRCm39) T57S probably damaging Het
Gask1a T C 9: 121,807,289 (GRCm39) F478L possibly damaging Het
Gjc2 A G 11: 59,068,185 (GRCm39) V99A possibly damaging Het
Gm9955 A T 18: 24,842,149 (GRCm39) probably benign Het
Gpr158 A G 2: 21,831,101 (GRCm39) I734V possibly damaging Het
H1f2 A G 13: 23,923,390 (GRCm39) S187G probably benign Het
Herc1 A T 9: 66,358,401 (GRCm39) H2494L probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmgcs1 A G 13: 120,161,351 (GRCm39) probably null Het
Invs A T 4: 48,416,084 (GRCm39) T655S probably benign Het
Ipo9 G A 1: 135,329,983 (GRCm39) L486F probably damaging Het
Katnip T C 7: 125,453,733 (GRCm39) V1150A probably benign Het
Kcnj6 A T 16: 94,633,824 (GRCm39) L96M probably benign Het
Lfng A G 5: 140,600,022 (GRCm39) D354G possibly damaging Het
Lgsn T C 1: 31,235,953 (GRCm39) L139P probably damaging Het
Madd C A 2: 90,993,890 (GRCm39) V923L probably damaging Het
Mical1 A T 10: 41,354,961 (GRCm39) I157F probably damaging Het
Mis18bp1 T C 12: 65,199,590 (GRCm39) N154S possibly damaging Het
Mrps14 A G 1: 160,023,105 (GRCm39) K6R probably benign Het
Mug1 T A 6: 121,838,032 (GRCm39) C421S probably damaging Het
Myo18b A G 5: 113,016,161 (GRCm39) I696T probably damaging Het
Naf1 T C 8: 67,336,197 (GRCm39) Y375H probably damaging Het
Nsf T A 11: 103,754,081 (GRCm39) E485V possibly damaging Het
Nup188 A G 2: 30,199,897 (GRCm39) D307G probably damaging Het
Ocel1 C A 8: 71,825,122 (GRCm39) P108T probably damaging Het
Oip5 A G 2: 119,443,540 (GRCm39) S177P probably damaging Het
Omg A G 11: 79,392,584 (GRCm39) W425R possibly damaging Het
Or1ad8 A C 11: 50,898,350 (GRCm39) I184L possibly damaging Het
Or1l4 A G 2: 37,091,942 (GRCm39) I230V probably benign Het
Or5an10 G A 19: 12,276,008 (GRCm39) Q163* probably null Het
Or8g26 A C 9: 39,095,480 (GRCm39) E2A probably benign Het
Pikfyve A G 1: 65,292,566 (GRCm39) Y1339C probably damaging Het
Polr3e A G 7: 120,522,172 (GRCm39) D6G possibly damaging Het
Pou4f3 C A 18: 42,528,480 (GRCm39) P141Q probably benign Het
Rcsd1 T A 1: 165,483,070 (GRCm39) N337I possibly damaging Het
Rhoj C T 12: 75,438,486 (GRCm39) P91S probably damaging Het
Rnf10 A G 5: 115,388,057 (GRCm39) F367S probably damaging Het
Rnft1 A T 11: 86,384,022 (GRCm39) R307S probably benign Het
Ryr3 A T 2: 112,585,222 (GRCm39) F2788Y probably damaging Het
Scgb1c1 A G 7: 140,426,137 (GRCm39) K78E possibly damaging Het
Scn5a G T 9: 119,389,352 (GRCm39) A123E probably damaging Het
Setd2 T A 9: 110,378,907 (GRCm39) Y623* probably null Het
Slc49a3 A T 5: 108,596,729 (GRCm39) M1K probably null Het
Spmap2l A G 5: 77,164,333 (GRCm39) D112G possibly damaging Het
Tbl2 C T 5: 135,186,445 (GRCm39) Q216* probably null Het
Trafd1 T C 5: 121,511,366 (GRCm39) K484R possibly damaging Het
Trank1 T C 9: 111,219,635 (GRCm39) V2124A probably damaging Het
Trpm4 A T 7: 44,959,756 (GRCm39) W713R probably damaging Het
Uap1l1 T C 2: 25,252,688 (GRCm39) T451A probably benign Het
Uba6 A T 5: 86,279,119 (GRCm39) C668S probably damaging Het
Ubxn11 T C 4: 133,853,935 (GRCm39) F441S probably damaging Het
Vmn1r22 C T 6: 57,877,723 (GRCm39) V85M probably damaging Het
Vmn2r72 T A 7: 85,401,150 (GRCm39) I90L probably damaging Het
Zfp330 T C 8: 83,491,585 (GRCm39) E196G probably benign Het
Zfp746 A G 6: 48,059,108 (GRCm39) V167A possibly damaging Het
Zfp994 T C 17: 22,420,694 (GRCm39) E85G possibly damaging Het
Other mutations in Tnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tnc APN 4 63,935,061 (GRCm39) splice site probably benign
IGL00531:Tnc APN 4 63,889,390 (GRCm39) splice site probably benign
IGL00674:Tnc APN 4 63,883,844 (GRCm39) missense probably damaging 1.00
IGL01015:Tnc APN 4 63,935,571 (GRCm39) missense probably benign 0.19
IGL01090:Tnc APN 4 63,918,317 (GRCm39) missense probably damaging 1.00
IGL01310:Tnc APN 4 63,931,314 (GRCm39) missense probably benign 0.03
IGL01331:Tnc APN 4 63,901,112 (GRCm39) missense probably damaging 0.99
IGL01393:Tnc APN 4 63,932,291 (GRCm39) splice site probably benign
IGL01411:Tnc APN 4 63,918,959 (GRCm39) missense probably damaging 0.96
IGL01472:Tnc APN 4 63,924,656 (GRCm39) missense probably benign 0.00
IGL01552:Tnc APN 4 63,888,645 (GRCm39) missense probably damaging 1.00
IGL01661:Tnc APN 4 63,888,544 (GRCm39) splice site probably benign
IGL01669:Tnc APN 4 63,918,938 (GRCm39) missense probably damaging 1.00
IGL01912:Tnc APN 4 63,926,977 (GRCm39) missense probably damaging 1.00
IGL02028:Tnc APN 4 63,884,909 (GRCm39) splice site probably benign
IGL02100:Tnc APN 4 63,918,398 (GRCm39) missense possibly damaging 0.84
IGL02549:Tnc APN 4 63,933,309 (GRCm39) missense probably damaging 1.00
IGL02642:Tnc APN 4 63,883,816 (GRCm39) splice site probably benign
IGL02712:Tnc APN 4 63,893,493 (GRCm39) missense probably damaging 1.00
IGL02876:Tnc APN 4 63,933,338 (GRCm39) missense possibly damaging 0.56
IGL02886:Tnc APN 4 63,918,344 (GRCm39) missense probably damaging 0.96
IGL02972:Tnc APN 4 63,894,715 (GRCm39) missense probably benign 0.11
IGL03073:Tnc APN 4 63,889,461 (GRCm39) missense possibly damaging 0.58
IGL03116:Tnc APN 4 63,932,270 (GRCm39) missense probably damaging 1.00
IGL03181:Tnc APN 4 63,885,543 (GRCm39) missense possibly damaging 0.95
IGL03358:Tnc APN 4 63,935,852 (GRCm39) nonsense probably null
tancredo UTSW 4 63,911,534 (GRCm39) nonsense probably null
BB009:Tnc UTSW 4 63,926,857 (GRCm39) missense probably benign
BB019:Tnc UTSW 4 63,926,857 (GRCm39) missense probably benign
P0020:Tnc UTSW 4 63,927,094 (GRCm39) missense possibly damaging 0.63
PIT4377001:Tnc UTSW 4 63,935,973 (GRCm39) missense probably damaging 1.00
PIT4403001:Tnc UTSW 4 63,882,904 (GRCm39) missense probably damaging 1.00
PIT4468001:Tnc UTSW 4 63,882,904 (GRCm39) missense probably damaging 1.00
R0243:Tnc UTSW 4 63,888,657 (GRCm39) missense probably damaging 0.98
R0362:Tnc UTSW 4 63,935,679 (GRCm39) missense probably damaging 1.00
R0410:Tnc UTSW 4 63,925,931 (GRCm39) missense probably benign 0.00
R0420:Tnc UTSW 4 63,918,396 (GRCm39) missense probably benign 0.00
R0540:Tnc UTSW 4 63,938,692 (GRCm39) missense probably damaging 1.00
R0650:Tnc UTSW 4 63,926,971 (GRCm39) missense probably benign 0.00
R1019:Tnc UTSW 4 63,880,319 (GRCm39) missense probably damaging 1.00
R1102:Tnc UTSW 4 63,938,705 (GRCm39) missense probably benign 0.05
R1126:Tnc UTSW 4 63,936,357 (GRCm39) missense probably damaging 0.99
R1141:Tnc UTSW 4 63,932,231 (GRCm39) missense probably damaging 1.00
R1142:Tnc UTSW 4 63,932,231 (GRCm39) missense probably damaging 1.00
R1307:Tnc UTSW 4 63,927,096 (GRCm39) missense probably damaging 0.98
R1322:Tnc UTSW 4 63,932,231 (GRCm39) missense probably damaging 1.00
R1414:Tnc UTSW 4 63,883,932 (GRCm39) splice site probably benign
R1470:Tnc UTSW 4 63,884,811 (GRCm39) missense probably damaging 1.00
R1470:Tnc UTSW 4 63,884,811 (GRCm39) missense probably damaging 1.00
R1499:Tnc UTSW 4 63,882,991 (GRCm39) missense probably benign 0.15
R1506:Tnc UTSW 4 63,925,921 (GRCm39) missense possibly damaging 0.90
R1597:Tnc UTSW 4 63,924,621 (GRCm39) missense probably benign
R1750:Tnc UTSW 4 63,890,972 (GRCm39) missense probably damaging 1.00
R1765:Tnc UTSW 4 63,932,231 (GRCm39) missense probably damaging 1.00
R1783:Tnc UTSW 4 63,936,333 (GRCm39) missense probably damaging 0.98
R1808:Tnc UTSW 4 63,918,168 (GRCm39) missense probably damaging 1.00
R1903:Tnc UTSW 4 63,918,299 (GRCm39) missense probably benign 0.00
R1932:Tnc UTSW 4 63,911,262 (GRCm39) critical splice donor site probably null
R1941:Tnc UTSW 4 63,933,201 (GRCm39) missense probably damaging 1.00
R1983:Tnc UTSW 4 63,902,867 (GRCm39) missense possibly damaging 0.95
R2024:Tnc UTSW 4 63,882,858 (GRCm39) missense probably damaging 1.00
R2075:Tnc UTSW 4 63,913,903 (GRCm39) missense possibly damaging 0.94
R2327:Tnc UTSW 4 63,893,475 (GRCm39) missense possibly damaging 0.78
R2444:Tnc UTSW 4 63,933,200 (GRCm39) missense probably damaging 1.00
R2982:Tnc UTSW 4 63,938,756 (GRCm39) missense possibly damaging 0.81
R3874:Tnc UTSW 4 63,926,947 (GRCm39) missense probably damaging 1.00
R4110:Tnc UTSW 4 63,933,188 (GRCm39) missense probably damaging 1.00
R4360:Tnc UTSW 4 63,935,161 (GRCm39) missense probably benign 0.35
R4371:Tnc UTSW 4 63,888,588 (GRCm39) missense probably damaging 1.00
R4434:Tnc UTSW 4 63,926,066 (GRCm39) missense possibly damaging 0.91
R4438:Tnc UTSW 4 63,926,066 (GRCm39) missense possibly damaging 0.91
R4570:Tnc UTSW 4 63,913,909 (GRCm39) missense probably damaging 0.99
R4595:Tnc UTSW 4 63,913,982 (GRCm39) missense probably damaging 1.00
R4749:Tnc UTSW 4 63,913,876 (GRCm39) missense possibly damaging 0.56
R4756:Tnc UTSW 4 63,885,580 (GRCm39) missense probably damaging 0.99
R4824:Tnc UTSW 4 63,935,857 (GRCm39) nonsense probably null
R4957:Tnc UTSW 4 63,894,793 (GRCm39) missense probably damaging 1.00
R4977:Tnc UTSW 4 63,924,485 (GRCm39) missense possibly damaging 0.82
R5001:Tnc UTSW 4 63,918,299 (GRCm39) missense probably benign 0.16
R5001:Tnc UTSW 4 63,902,726 (GRCm39) missense probably damaging 1.00
R5015:Tnc UTSW 4 63,924,739 (GRCm39) missense probably damaging 1.00
R5049:Tnc UTSW 4 63,936,223 (GRCm39) missense probably damaging 1.00
R5066:Tnc UTSW 4 63,893,466 (GRCm39) missense probably damaging 0.96
R5073:Tnc UTSW 4 63,938,648 (GRCm39) missense probably damaging 1.00
R5116:Tnc UTSW 4 63,885,452 (GRCm39) critical splice donor site probably null
R5195:Tnc UTSW 4 63,885,489 (GRCm39) missense probably damaging 1.00
R5200:Tnc UTSW 4 63,889,515 (GRCm39) missense probably damaging 1.00
R5221:Tnc UTSW 4 63,911,534 (GRCm39) nonsense probably null
R5237:Tnc UTSW 4 63,880,333 (GRCm39) missense probably damaging 1.00
R5265:Tnc UTSW 4 63,911,443 (GRCm39) missense probably benign 0.00
R5275:Tnc UTSW 4 63,882,967 (GRCm39) nonsense probably null
R5346:Tnc UTSW 4 63,926,892 (GRCm39) missense probably benign
R5409:Tnc UTSW 4 63,925,654 (GRCm39) missense probably damaging 1.00
R5409:Tnc UTSW 4 63,884,773 (GRCm39) missense probably damaging 1.00
R5469:Tnc UTSW 4 63,932,162 (GRCm39) splice site probably null
R5518:Tnc UTSW 4 63,935,916 (GRCm39) missense probably damaging 1.00
R5588:Tnc UTSW 4 63,924,659 (GRCm39) missense possibly damaging 0.57
R5686:Tnc UTSW 4 63,925,967 (GRCm39) splice site probably null
R5686:Tnc UTSW 4 63,927,032 (GRCm39) missense possibly damaging 0.78
R5837:Tnc UTSW 4 63,931,451 (GRCm39) missense probably damaging 1.00
R5976:Tnc UTSW 4 63,936,403 (GRCm39) missense probably benign 0.17
R6156:Tnc UTSW 4 63,888,589 (GRCm39) missense probably damaging 1.00
R6182:Tnc UTSW 4 63,927,033 (GRCm39) missense probably damaging 0.99
R6360:Tnc UTSW 4 63,918,970 (GRCm39) missense probably damaging 1.00
R6416:Tnc UTSW 4 63,926,053 (GRCm39) missense probably benign 0.05
R6778:Tnc UTSW 4 63,913,835 (GRCm39) missense probably benign 0.12
R6798:Tnc UTSW 4 63,883,841 (GRCm39) missense probably benign 0.02
R6799:Tnc UTSW 4 63,883,841 (GRCm39) missense probably benign 0.02
R6943:Tnc UTSW 4 63,900,982 (GRCm39) missense probably damaging 0.97
R7027:Tnc UTSW 4 63,902,826 (GRCm39) missense probably benign 0.02
R7183:Tnc UTSW 4 63,931,365 (GRCm39) missense probably damaging 1.00
R7204:Tnc UTSW 4 63,889,392 (GRCm39) splice site probably null
R7317:Tnc UTSW 4 63,890,959 (GRCm39) missense probably damaging 0.99
R7323:Tnc UTSW 4 63,889,469 (GRCm39) missense probably damaging 0.96
R7327:Tnc UTSW 4 63,882,999 (GRCm39) splice site probably null
R7382:Tnc UTSW 4 63,932,280 (GRCm39) nonsense probably null
R7399:Tnc UTSW 4 63,938,894 (GRCm39) start gained probably benign
R7479:Tnc UTSW 4 63,935,865 (GRCm39) missense possibly damaging 0.95
R7585:Tnc UTSW 4 63,938,648 (GRCm39) missense probably damaging 1.00
R7932:Tnc UTSW 4 63,926,857 (GRCm39) missense probably benign
R7947:Tnc UTSW 4 63,935,580 (GRCm39) missense probably damaging 1.00
R7974:Tnc UTSW 4 63,918,961 (GRCm39) missense possibly damaging 0.84
R7991:Tnc UTSW 4 63,926,983 (GRCm39) missense probably benign 0.42
R8004:Tnc UTSW 4 63,902,894 (GRCm39) missense probably benign 0.04
R8080:Tnc UTSW 4 63,894,706 (GRCm39) missense possibly damaging 0.52
R8109:Tnc UTSW 4 63,927,000 (GRCm39) missense probably benign 0.11
R8145:Tnc UTSW 4 63,935,716 (GRCm39) missense probably benign
R8340:Tnc UTSW 4 63,926,036 (GRCm39) missense probably damaging 1.00
R8360:Tnc UTSW 4 63,885,511 (GRCm39) missense probably benign 0.00
R8671:Tnc UTSW 4 63,935,683 (GRCm39) missense probably damaging 1.00
R8691:Tnc UTSW 4 63,880,313 (GRCm39) missense probably damaging 1.00
R8759:Tnc UTSW 4 63,924,501 (GRCm39) missense possibly damaging 0.86
R8864:Tnc UTSW 4 63,911,296 (GRCm39) missense probably damaging 0.98
R8927:Tnc UTSW 4 63,925,595 (GRCm39) missense probably damaging 1.00
R8928:Tnc UTSW 4 63,925,595 (GRCm39) missense probably damaging 1.00
R8949:Tnc UTSW 4 63,927,087 (GRCm39) missense probably damaging 1.00
R8956:Tnc UTSW 4 63,918,970 (GRCm39) missense probably damaging 1.00
R9016:Tnc UTSW 4 63,935,331 (GRCm39) missense probably benign 0.23
R9049:Tnc UTSW 4 63,918,247 (GRCm39) missense possibly damaging 0.83
R9097:Tnc UTSW 4 63,888,622 (GRCm39) missense possibly damaging 0.62
R9114:Tnc UTSW 4 63,890,973 (GRCm39) missense probably benign 0.03
R9151:Tnc UTSW 4 63,938,686 (GRCm39) missense possibly damaging 0.46
R9488:Tnc UTSW 4 63,913,942 (GRCm39) missense probably damaging 0.99
R9537:Tnc UTSW 4 63,884,821 (GRCm39) missense probably damaging 0.99
R9666:Tnc UTSW 4 63,926,045 (GRCm39) missense probably damaging 1.00
R9700:Tnc UTSW 4 63,933,186 (GRCm39) missense probably damaging 0.99
R9703:Tnc UTSW 4 63,889,412 (GRCm39) missense probably benign 0.00
R9771:Tnc UTSW 4 63,925,600 (GRCm39) missense probably damaging 1.00
S24628:Tnc UTSW 4 63,936,249 (GRCm39) missense probably damaging 1.00
Z1177:Tnc UTSW 4 63,925,663 (GRCm39) nonsense probably null
Z1177:Tnc UTSW 4 63,878,781 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCATCTTTAGTGCTATATGGGCC -3'
(R):5'- TGCTGCAAAGTCCCCACTAC -3'

Sequencing Primer
(F):5'- CTATATGGGCCTGGAGGACTC -3'
(R):5'- GCCGGCATTGACCCTTTG -3'
Posted On 2016-10-24