Incidental Mutation 'R0006:Igdcc4'
ID43651
Institutional Source Beutler Lab
Gene Symbol Igdcc4
Ensembl Gene ENSMUSG00000032816
Gene Nameimmunoglobulin superfamily, DCC subclass, member 4
SynonymsWI-18508, WI-16786, Nope, 9330155G14Rik
MMRRC Submission 041980-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R0006 (G1)
Quality Score123
Status Validated
Chromosome9
Chromosomal Location65101486-65137940 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to T at 65135100 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035499] [ENSMUST00000077696] [ENSMUST00000166273] [ENSMUST00000213533]
Predicted Effect probably benign
Transcript: ENSMUST00000035499
SMART Domains Protein: ENSMUSP00000045387
Gene: ENSMUSG00000032816

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 40 139 5e0 SMART
IGc2 154 218 1.3e-11 SMART
IGc2 255 318 1.13e-11 SMART
low complexity region 322 335 N/A INTRINSIC
IGc2 346 411 1.34e-13 SMART
FN3 428 511 3.58e-12 SMART
FN3 526 610 9.54e-8 SMART
FN3 630 726 7.34e-9 SMART
FN3 750 832 1.05e-9 SMART
FN3 848 932 2.14e-10 SMART
low complexity region 958 978 N/A INTRINSIC
low complexity region 1085 1100 N/A INTRINSIC
low complexity region 1154 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077696
SMART Domains Protein: ENSMUSP00000076878
Gene: ENSMUSG00000032816

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 40 139 5e0 SMART
IGc2 154 218 1.3e-11 SMART
IGc2 255 458 7.02e-8 SMART
FN3 475 558 3.58e-12 SMART
FN3 573 656 1.1e-7 SMART
FN3 676 772 7.34e-9 SMART
FN3 796 878 1.05e-9 SMART
FN3 894 978 2.14e-10 SMART
low complexity region 1004 1024 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
low complexity region 1200 1214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166273
SMART Domains Protein: ENSMUSP00000132576
Gene: ENSMUSG00000032816

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Blast:IG 40 83 3e-22 BLAST
low complexity region 142 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213533
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214978
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Igdcc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Igdcc4 APN 9 65135164 missense probably damaging 1.00
IGL01285:Igdcc4 APN 9 65123991 missense probably damaging 1.00
IGL01412:Igdcc4 APN 9 65114449 splice site probably benign
IGL01485:Igdcc4 APN 9 65122607 missense probably benign 0.02
IGL01552:Igdcc4 APN 9 65122502 intron probably benign
IGL01651:Igdcc4 APN 9 65124112 missense possibly damaging 0.63
IGL01751:Igdcc4 APN 9 65131732 missense probably damaging 1.00
IGL02164:Igdcc4 APN 9 65124782 splice site probably benign
IGL02468:Igdcc4 APN 9 65126832 missense probably damaging 1.00
IGL02616:Igdcc4 APN 9 65133078 missense probably damaging 1.00
IGL02685:Igdcc4 APN 9 65133825 missense possibly damaging 0.81
IGL02734:Igdcc4 APN 9 65131456 missense possibly damaging 0.47
IGL02893:Igdcc4 APN 9 65133071 missense probably damaging 1.00
R0583:Igdcc4 UTSW 9 65121813 missense possibly damaging 0.85
R0939:Igdcc4 UTSW 9 65131473 critical splice donor site probably null
R1075:Igdcc4 UTSW 9 65131650 missense possibly damaging 0.90
R1110:Igdcc4 UTSW 9 65126926 missense possibly damaging 0.91
R1183:Igdcc4 UTSW 9 65121900 missense possibly damaging 0.91
R1318:Igdcc4 UTSW 9 65133690 missense probably damaging 1.00
R1507:Igdcc4 UTSW 9 65133744 missense probably damaging 1.00
R1548:Igdcc4 UTSW 9 65135227 missense probably benign 0.08
R1640:Igdcc4 UTSW 9 65122795 missense probably damaging 1.00
R1681:Igdcc4 UTSW 9 65128795 missense probably damaging 1.00
R1687:Igdcc4 UTSW 9 65131663 missense probably damaging 1.00
R1716:Igdcc4 UTSW 9 65126897 missense probably damaging 1.00
R1964:Igdcc4 UTSW 9 65122769 missense probably benign
R1996:Igdcc4 UTSW 9 65121819 missense probably damaging 1.00
R2150:Igdcc4 UTSW 9 65125335 missense possibly damaging 0.92
R2278:Igdcc4 UTSW 9 65130743 missense probably damaging 1.00
R3085:Igdcc4 UTSW 9 65132058 missense probably damaging 1.00
R4011:Igdcc4 UTSW 9 65135479 missense probably benign
R4077:Igdcc4 UTSW 9 65131765 missense probably damaging 1.00
R4191:Igdcc4 UTSW 9 65124151 missense probably benign 0.13
R4293:Igdcc4 UTSW 9 65124610 critical splice acceptor site probably null
R4589:Igdcc4 UTSW 9 65130628 missense probably damaging 1.00
R4931:Igdcc4 UTSW 9 65124015 missense possibly damaging 0.66
R5093:Igdcc4 UTSW 9 65122757 missense possibly damaging 0.51
R5106:Igdcc4 UTSW 9 65124701 missense probably damaging 1.00
R5546:Igdcc4 UTSW 9 65128795 missense probably damaging 1.00
R5634:Igdcc4 UTSW 9 65134546 missense probably benign 0.18
R5810:Igdcc4 UTSW 9 65128695 missense probably damaging 1.00
R6395:Igdcc4 UTSW 9 65135118 missense probably damaging 1.00
R6475:Igdcc4 UTSW 9 65120321 missense probably damaging 1.00
R6776:Igdcc4 UTSW 9 65135418 missense probably benign 0.02
R6828:Igdcc4 UTSW 9 65122697 missense probably benign
R6914:Igdcc4 UTSW 9 65120268 missense probably benign 0.00
R6942:Igdcc4 UTSW 9 65120268 missense probably benign 0.00
R7072:Igdcc4 UTSW 9 65130731 missense probably damaging 1.00
R7234:Igdcc4 UTSW 9 65135468 nonsense probably null
R7448:Igdcc4 UTSW 9 65123994 missense possibly damaging 0.52
R7562:Igdcc4 UTSW 9 65124024 missense probably damaging 1.00
R7607:Igdcc4 UTSW 9 65133758 missense possibly damaging 0.85
R7734:Igdcc4 UTSW 9 65131753 missense probably damaging 0.99
R7807:Igdcc4 UTSW 9 65133795 missense probably benign 0.00
R7852:Igdcc4 UTSW 9 65120258 missense probably benign 0.04
R7904:Igdcc4 UTSW 9 65134519 missense probably benign 0.00
R7935:Igdcc4 UTSW 9 65120258 missense probably benign 0.04
R7987:Igdcc4 UTSW 9 65134519 missense probably benign 0.00
R8133:Igdcc4 UTSW 9 65131741 missense possibly damaging 0.54
R8147:Igdcc4 UTSW 9 65123971 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- AGGTGGCCTTAGCCCCTTAGATAC -3'
(R):5'- TCCTTGAGACAGATCCACAGCTCC -3'

Sequencing Primer
(F):5'- TAGCCCCTTAGATACGGCCAG -3'
(R):5'- CACAGCTCCAGACGTGGAAG -3'
Posted On2013-05-29