Incidental Mutation 'R5560:Rnf10'
ID436513
Institutional Source Beutler Lab
Gene Symbol Rnf10
Ensembl Gene ENSMUSG00000041740
Gene Namering finger protein 10
Synonyms
MMRRC Submission 043117-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.590) question?
Stock #R5560 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location115241412-115272898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115249998 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 367 (F367S)
Ref Sequence ENSEMBL: ENSMUSP00000107726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040555] [ENSMUST00000112096] [ENSMUST00000112097] [ENSMUST00000135455]
Predicted Effect probably damaging
Transcript: ENSMUST00000040555
AA Change: F367S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041778
Gene: ENSMUSG00000041740
AA Change: F367S

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 781 792 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112096
AA Change: F367S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107725
Gene: ENSMUSG00000041740
AA Change: F367S

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 439 461 N/A INTRINSIC
low complexity region 591 618 N/A INTRINSIC
low complexity region 660 671 N/A INTRINSIC
low complexity region 782 793 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112097
AA Change: F367S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107726
Gene: ENSMUSG00000041740
AA Change: F367S

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 18 31 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
RING 225 266 1.98e-8 SMART
low complexity region 379 400 N/A INTRINSIC
low complexity region 440 462 N/A INTRINSIC
low complexity region 592 619 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133276
Predicted Effect probably benign
Transcript: ENSMUST00000135455
SMART Domains Protein: ENSMUSP00000118408
Gene: ENSMUSG00000060152

DomainStartEndE-ValueType
Pfam:RNase_P_Rpp14 7 117 3.7e-31 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000139853
AA Change: F329S
SMART Domains Protein: ENSMUSP00000131696
Gene: ENSMUSG00000041740
AA Change: F329S

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
low complexity region 63 77 N/A INTRINSIC
low complexity region 115 129 N/A INTRINSIC
RING 188 229 1.98e-8 SMART
low complexity region 342 363 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 554 581 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152613
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoding this gene is a member of the really interesting new gene finger protein family. Members of this family contain protein motifs similar to zinc finger domains and are involved in many processes that include transcriptional regulation, DNA repair and signal transduction. Expression of this gene is upregulated during neuronal differentiation of cultured cells, and inhibition of its expression impairs differentiation and cell cycle exit, providing evidence for a function in neuronal differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adipor1 T C 1: 134,426,040 W188R possibly damaging Het
Agrn T C 4: 156,178,497 D441G probably damaging Het
Ankrd55 T C 13: 112,383,490 S570P probably benign Het
Ano9 C G 7: 141,110,482 G80R probably damaging Het
Arhgef2 T A 3: 88,634,437 V250E probably damaging Het
Atp2b2 T C 6: 113,774,358 D583G possibly damaging Het
Bcar3 T A 3: 122,426,575 D40E possibly damaging Het
Capn12 A G 7: 28,882,860 D133G probably benign Het
Ccna1 A T 3: 55,048,569 Y269N probably damaging Het
Cct6b A T 11: 82,741,413 Y250N probably damaging Het
Cep112 A C 11: 108,437,235 K98Q probably damaging Het
Chst13 T C 6: 90,318,269 D54G probably damaging Het
Clstn2 G T 9: 97,469,819 H518N possibly damaging Het
Cntnap1 T A 11: 101,182,435 L581M probably damaging Het
Cog3 T A 14: 75,729,393 M446L probably damaging Het
D430042O09Rik T C 7: 125,854,561 V1150A probably benign Het
Dennd2c T A 3: 103,161,555 I756K probably damaging Het
Dennd3 T G 15: 73,532,895 L273R probably damaging Het
Dhx34 C A 7: 16,218,541 R53L probably benign Het
Dnah9 G A 11: 65,881,740 T3722I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dusp6 A G 10: 99,266,241 Y217C probably damaging Het
Dyrk1b G A 7: 28,184,253 R178Q possibly damaging Het
Eif4g1 T A 16: 20,686,895 C1009S probably benign Het
Fam198a T C 9: 121,978,223 F478L possibly damaging Het
Frmpd1 A T 4: 45,243,697 T57S probably damaging Het
Gjc2 A G 11: 59,177,359 V99A possibly damaging Het
Gm9955 A T 18: 24,709,092 probably benign Het
Gpr158 A G 2: 21,826,290 I734V possibly damaging Het
Herc1 A T 9: 66,451,119 H2494L probably benign Het
Hist1h1c A G 13: 23,739,407 S187G probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmgcs1 A G 13: 119,699,815 probably null Het
Invs A T 4: 48,416,084 T655S probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Kcnj6 A T 16: 94,832,965 L96M probably benign Het
Lfng A G 5: 140,614,267 D354G possibly damaging Het
Lgsn T C 1: 31,196,872 L139P probably damaging Het
Madd C A 2: 91,163,545 V923L probably damaging Het
Mfsd7a A T 5: 108,448,863 M1K probably null Het
Mical1 A T 10: 41,478,965 I157F probably damaging Het
Mis18bp1 T C 12: 65,152,816 N154S possibly damaging Het
Mrps14 A G 1: 160,195,535 K6R probably benign Het
Mug1 T A 6: 121,861,073 C421S probably damaging Het
Myo18b A G 5: 112,868,295 I696T probably damaging Het
Naf1 T C 8: 66,883,545 Y375H probably damaging Het
Nsf T A 11: 103,863,255 E485V possibly damaging Het
Nup188 A G 2: 30,309,885 D307G probably damaging Het
Ocel1 C A 8: 71,372,478 P108T probably damaging Het
Oip5 A G 2: 119,613,059 S177P probably damaging Het
Olfr1436 G A 19: 12,298,644 Q163* probably null Het
Olfr365 A G 2: 37,201,930 I230V probably benign Het
Olfr51 A C 11: 51,007,523 I184L possibly damaging Het
Olfr943 A C 9: 39,184,184 E2A probably benign Het
Omg A G 11: 79,501,758 W425R possibly damaging Het
Pikfyve A G 1: 65,253,407 Y1339C probably damaging Het
Polr3e A G 7: 120,922,949 D6G possibly damaging Het
Pou4f3 C A 18: 42,395,415 P141Q probably benign Het
Rcsd1 T A 1: 165,655,501 N337I possibly damaging Het
Rhoj C T 12: 75,391,712 P91S probably damaging Het
Rnft1 A T 11: 86,493,196 R307S probably benign Het
Ryr3 A T 2: 112,754,877 F2788Y probably damaging Het
Scgb1c1 A G 7: 140,846,224 K78E possibly damaging Het
Scn5a G T 9: 119,560,286 A123E probably damaging Het
Setd2 T A 9: 110,549,839 Y623* probably null Het
Tbl2 C T 5: 135,157,591 Q216* probably null Het
Thegl A G 5: 77,016,486 D112G possibly damaging Het
Tnc A G 4: 64,008,709 I860T probably damaging Het
Trafd1 T C 5: 121,373,303 K484R possibly damaging Het
Trank1 T C 9: 111,390,567 V2124A probably damaging Het
Trpm4 A T 7: 45,310,332 W713R probably damaging Het
Uap1l1 T C 2: 25,362,676 T451A probably benign Het
Uba6 A T 5: 86,131,260 C668S probably damaging Het
Ubxn11 T C 4: 134,126,624 F441S probably damaging Het
Vmn1r22 C T 6: 57,900,738 V85M probably damaging Het
Vmn2r72 T A 7: 85,751,942 I90L probably damaging Het
Wdr60 T C 12: 116,218,113 S769G probably damaging Het
Zfp330 T C 8: 82,764,956 E196G probably benign Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp994 T C 17: 22,201,713 E85G possibly damaging Het
Other mutations in Rnf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Rnf10 APN 5 115256983 missense probably damaging 1.00
IGL01995:Rnf10 APN 5 115251102 nonsense probably null
IGL02291:Rnf10 APN 5 115260196 missense probably damaging 1.00
IGL02751:Rnf10 APN 5 115242666 missense probably benign 0.20
IGL02897:Rnf10 APN 5 115248641 missense probably benign
IGL02968:Rnf10 APN 5 115245888 missense probably benign 0.05
IGL03008:Rnf10 APN 5 115251296 missense possibly damaging 0.92
IGL03098:Rnf10 UTSW 5 115272367 missense probably damaging 1.00
R0409:Rnf10 UTSW 5 115255447 splice site probably benign
R1083:Rnf10 UTSW 5 115260104 splice site probably benign
R1754:Rnf10 UTSW 5 115245865 missense probably damaging 0.99
R1957:Rnf10 UTSW 5 115260322 splice site probably benign
R2398:Rnf10 UTSW 5 115247273 missense probably benign 0.33
R2848:Rnf10 UTSW 5 115249112 missense probably benign
R2849:Rnf10 UTSW 5 115249112 missense probably benign
R4527:Rnf10 UTSW 5 115260151 missense probably damaging 0.96
R4617:Rnf10 UTSW 5 115248703 missense probably damaging 1.00
R4673:Rnf10 UTSW 5 115251089 missense probably damaging 0.99
R4823:Rnf10 UTSW 5 115255442 critical splice acceptor site probably null
R5805:Rnf10 UTSW 5 115244068 missense probably benign
R6192:Rnf10 UTSW 5 115257077 missense probably damaging 1.00
R7061:Rnf10 UTSW 5 115257090 missense probably damaging 0.98
R7206:Rnf10 UTSW 5 115244121 missense probably benign 0.04
R7213:Rnf10 UTSW 5 115242473 missense probably damaging 1.00
R7213:Rnf10 UTSW 5 115242474 missense probably damaging 1.00
R7429:Rnf10 UTSW 5 115248680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGAGTCAGGACAACCATTC -3'
(R):5'- AGGAGGTTGCACTGTTAGTCC -3'

Sequencing Primer
(F):5'- ACAACCATTCGGGGCTGTG -3'
(R):5'- GAGGTTGCACTGTTAGTCCCATTTTC -3'
Posted On2016-10-24