Mutagenetix > Incidental Mutation

Incidental Mutation 'R5560:Lfng'

436516

Institutional Source

Beutler Lab

Gene Symbol

Lfng

Ensembl Gene

ENSMUSG00000029570

Gene Name

LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase

Synonyms

lunatic fringe

MMRRC Submission

043117-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.898) question?

Stock #

R5560 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

140607320-140615545 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 140614267 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 354 (D354G)

Ref Sequence

ENSEMBL: ENSMUSP00000031555 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031555]

AlphaFold

O09010

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031555
AA Change: D354G

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000031555
Gene: ENSMUSG00000029570
AA Change: D354G

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	37	60	N/A	INTRINSIC
Pfam:Fringe	107	357	9.6e-124	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199848

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200626

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.7%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the fringe gene family which also includes radical and manic fringe genes. They all encode evolutionarily conserved glycosyltransferases that act in the Notch signaling pathway to define boundaries during embryonic development. While their genomic structure is distinct from other glycosyltransferases, fringe proteins have a fucose-specific beta-1,3-N-acetylglucosaminyltransferase activity that leads to elongation of O-linked fucose residues on Notch, which alters Notch signaling. This gene product is predicted to be a single-pass type II Golgi membrane protein but it may also be secreted and proteolytically processed like the related proteins in mouse and Drosophila (PMID: 9187150). Mutations in this gene have been associated with autosomal recessive spondylocostal dysostosis 3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a short tail and abnormal rib, somite, and lung development. Mice homozygous mice exhibit reduced female fertility, abnormal hair cells, and abnormal axial skeleton morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adipor1	T	C	1: 134,426,040	W188R	possibly damaging	Het
Agrn	T	C	4: 156,178,497	D441G	probably damaging	Het
Ankrd55	T	C	13: 112,383,490	S570P	probably benign	Het
Ano9	C	G	7: 141,110,482	G80R	probably damaging	Het
Arhgef2	T	A	3: 88,634,437	V250E	probably damaging	Het
Atp2b2	T	C	6: 113,774,358	D583G	possibly damaging	Het
Bcar3	T	A	3: 122,426,575	D40E	possibly damaging	Het
Capn12	A	G	7: 28,882,860	D133G	probably benign	Het
Ccna1	A	T	3: 55,048,569	Y269N	probably damaging	Het
Cct6b	A	T	11: 82,741,413	Y250N	probably damaging	Het
Cep112	A	C	11: 108,437,235	K98Q	probably damaging	Het
Chst13	T	C	6: 90,318,269	D54G	probably damaging	Het
Clstn2	G	T	9: 97,469,819	H518N	possibly damaging	Het
Cntnap1	T	A	11: 101,182,435	L581M	probably damaging	Het
Cog3	T	A	14: 75,729,393	M446L	probably damaging	Het
D430042O09Rik	T	C	7: 125,854,561	V1150A	probably benign	Het
Dennd2c	T	A	3: 103,161,555	I756K	probably damaging	Het
Dennd3	T	G	15: 73,532,895	L273R	probably damaging	Het
Dhx34	C	A	7: 16,218,541	R53L	probably benign	Het
Dnah9	G	A	11: 65,881,740	T3722I	probably benign	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
Dusp6	A	G	10: 99,266,241	Y217C	probably damaging	Het
Dyrk1b	G	A	7: 28,184,253	R178Q	possibly damaging	Het
Eif4g1	T	A	16: 20,686,895	C1009S	probably benign	Het
Fam198a	T	C	9: 121,978,223	F478L	possibly damaging	Het
Frmpd1	A	T	4: 45,243,697	T57S	probably damaging	Het
Gjc2	A	G	11: 59,177,359	V99A	possibly damaging	Het
Gm9955	A	T	18: 24,709,092		probably benign	Het
Gpr158	A	G	2: 21,826,290	I734V	possibly damaging	Het
Herc1	A	T	9: 66,451,119	H2494L	probably benign	Het
Hist1h1c	A	G	13: 23,739,407	S187G	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hmgcs1	A	G	13: 119,699,815		probably null	Het
Invs	A	T	4: 48,416,084	T655S	probably benign	Het
Ipo9	G	A	1: 135,402,245	L486F	probably damaging	Het
Kcnj6	A	T	16: 94,832,965	L96M	probably benign	Het
Lgsn	T	C	1: 31,196,872	L139P	probably damaging	Het
Madd	C	A	2: 91,163,545	V923L	probably damaging	Het
Mfsd7a	A	T	5: 108,448,863	M1K	probably null	Het
Mical1	A	T	10: 41,478,965	I157F	probably damaging	Het
Mis18bp1	T	C	12: 65,152,816	N154S	possibly damaging	Het
Mrps14	A	G	1: 160,195,535	K6R	probably benign	Het
Mug1	T	A	6: 121,861,073	C421S	probably damaging	Het
Myo18b	A	G	5: 112,868,295	I696T	probably damaging	Het
Naf1	T	C	8: 66,883,545	Y375H	probably damaging	Het
Nsf	T	A	11: 103,863,255	E485V	possibly damaging	Het
Nup188	A	G	2: 30,309,885	D307G	probably damaging	Het
Ocel1	C	A	8: 71,372,478	P108T	probably damaging	Het
Oip5	A	G	2: 119,613,059	S177P	probably damaging	Het
Olfr1436	G	A	19: 12,298,644	Q163*	probably null	Het
Olfr365	A	G	2: 37,201,930	I230V	probably benign	Het
Olfr51	A	C	11: 51,007,523	I184L	possibly damaging	Het
Olfr943	A	C	9: 39,184,184	E2A	probably benign	Het
Omg	A	G	11: 79,501,758	W425R	possibly damaging	Het
Pikfyve	A	G	1: 65,253,407	Y1339C	probably damaging	Het
Polr3e	A	G	7: 120,922,949	D6G	possibly damaging	Het
Pou4f3	C	A	18: 42,395,415	P141Q	probably benign	Het
Rcsd1	T	A	1: 165,655,501	N337I	possibly damaging	Het
Rhoj	C	T	12: 75,391,712	P91S	probably damaging	Het
Rnf10	A	G	5: 115,249,998	F367S	probably damaging	Het
Rnft1	A	T	11: 86,493,196	R307S	probably benign	Het
Ryr3	A	T	2: 112,754,877	F2788Y	probably damaging	Het
Scgb1c1	A	G	7: 140,846,224	K78E	possibly damaging	Het
Scn5a	G	T	9: 119,560,286	A123E	probably damaging	Het
Setd2	T	A	9: 110,549,839	Y623*	probably null	Het
Tbl2	C	T	5: 135,157,591	Q216*	probably null	Het
Thegl	A	G	5: 77,016,486	D112G	possibly damaging	Het
Tnc	A	G	4: 64,008,709	I860T	probably damaging	Het
Trafd1	T	C	5: 121,373,303	K484R	possibly damaging	Het
Trank1	T	C	9: 111,390,567	V2124A	probably damaging	Het
Trpm4	A	T	7: 45,310,332	W713R	probably damaging	Het
Uap1l1	T	C	2: 25,362,676	T451A	probably benign	Het
Uba6	A	T	5: 86,131,260	C668S	probably damaging	Het
Ubxn11	T	C	4: 134,126,624	F441S	probably damaging	Het
Vmn1r22	C	T	6: 57,900,738	V85M	probably damaging	Het
Vmn2r72	T	A	7: 85,751,942	I90L	probably damaging	Het
Wdr60	T	C	12: 116,218,113	S769G	probably damaging	Het
Zfp330	T	C	8: 82,764,956	E196G	probably benign	Het
Zfp746	A	G	6: 48,082,174	V167A	possibly damaging	Het
Zfp994	T	C	17: 22,201,713	E85G	possibly damaging	Het

Other mutations in Lfng

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01599:Lfng	APN	5	140612535	missense	probably damaging	1.00
zigzag	UTSW	5	140612535	missense	probably damaging	1.00
PIT4305001:Lfng	UTSW	5	140612528	missense	probably damaging	1.00
R2070:Lfng	UTSW	5	140612595	missense	possibly damaging	0.63
R2848:Lfng	UTSW	5	140611867	missense	probably damaging	1.00
R2849:Lfng	UTSW	5	140611867	missense	probably damaging	1.00
R4689:Lfng	UTSW	5	140614439	missense	probably damaging	0.99
R4936:Lfng	UTSW	5	140612395	splice site	probably null
R5516:Lfng	UTSW	5	140613263	missense	probably damaging	1.00
R6334:Lfng	UTSW	5	140612767	missense	possibly damaging	0.86
R6380:Lfng	UTSW	5	140614396	splice site	probably null
R6627:Lfng	UTSW	5	140607768	missense	probably damaging	1.00
R7832:Lfng	UTSW	5	140612833	missense	probably benign	0.07
R7853:Lfng	UTSW	5	140607629	missense	probably benign	0.01
R8367:Lfng	UTSW	5	140613226	missense	probably damaging	1.00
R8368:Lfng	UTSW	5	140613226	missense	probably damaging	1.00
R8384:Lfng	UTSW	5	140613226	missense	probably damaging	1.00
R8385:Lfng	UTSW	5	140613226	missense	probably damaging	1.00
R8407:Lfng	UTSW	5	140613226	missense	probably damaging	1.00
R8435:Lfng	UTSW	5	140613226	missense	probably damaging	1.00
R8494:Lfng	UTSW	5	140613226	missense	probably damaging	1.00
R8896:Lfng	UTSW	5	140613223	missense	probably benign	0.15
R9803:Lfng	UTSW	5	140607773	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCCCTTATGGTCGTAGGC -3'
(R):5'- CACGACTGCTAGAAGATGGC -3'

Sequencing Primer
(F):5'- TCGTAGGCCCCACCATG -3'
(R):5'- CCAGGGTGTGTCTGGGTACAG -3'

Posted On

2016-10-24