Incidental Mutation 'R0006:Als2cl'
ID43652
Institutional Source Beutler Lab
Gene Symbol Als2cl
Ensembl Gene ENSMUSG00000044037
Gene NameALS2 C-terminal like
SynonymsmRn.49018, D930044G19Rik
MMRRC Submission 041980-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R0006 (G1)
Quality Score108
Status Not validated
Chromosome9
Chromosomal Location110879870-110900530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110894618 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 694 (L694Q)
Ref Sequence ENSEMBL: ENSMUSP00000115718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084926] [ENSMUST00000130386] [ENSMUST00000155014]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084926
AA Change: L694Q

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081989
Gene: ENSMUSG00000044037
AA Change: L694Q

DomainStartEndE-ValueType
SCOP:d1by1a_ 8 215 2e-3 SMART
Blast:PH 220 318 8e-7 BLAST
MORN 356 377 1.83e-3 SMART
Pfam:MORN 381 397 4.5e-4 PFAM
MORN 407 428 1.2e1 SMART
MORN 430 451 3.71e-1 SMART
MORN 457 478 4.33e-1 SMART
MORN 481 502 3.18e-1 SMART
MORN 504 525 1.68e0 SMART
MORN 527 549 3.63e1 SMART
Pfam:VPS9 833 937 1.3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130386
AA Change: L694Q

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123304
Gene: ENSMUSG00000044037
AA Change: L694Q

DomainStartEndE-ValueType
SCOP:d1by1a_ 8 215 2e-3 SMART
Blast:PH 220 318 8e-7 BLAST
MORN 356 377 1.83e-3 SMART
Pfam:MORN 381 397 4.5e-4 PFAM
MORN 407 428 1.2e1 SMART
MORN 430 451 3.71e-1 SMART
MORN 457 478 4.33e-1 SMART
MORN 481 502 3.18e-1 SMART
MORN 504 525 1.68e0 SMART
MORN 527 549 3.63e1 SMART
Pfam:VPS9 833 937 1.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141845
Predicted Effect possibly damaging
Transcript: ENSMUST00000155014
AA Change: L694Q

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115718
Gene: ENSMUSG00000044037
AA Change: L694Q

DomainStartEndE-ValueType
SCOP:d1by1a_ 8 215 2e-3 SMART
Blast:PH 220 318 8e-7 BLAST
MORN 356 377 1.83e-3 SMART
Pfam:MORN 381 399 5.6e-4 PFAM
MORN 407 428 1.2e1 SMART
MORN 430 451 3.71e-1 SMART
MORN 457 478 4.33e-1 SMART
MORN 481 502 3.18e-1 SMART
MORN 504 525 1.68e0 SMART
MORN 527 549 3.63e1 SMART
Pfam:VPS9 833 937 1.7e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195890
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Als2cl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Als2cl APN 9 110886539 critical splice donor site probably null
IGL00743:Als2cl APN 9 110889159 missense possibly damaging 0.88
IGL01504:Als2cl APN 9 110889283 missense probably benign 0.05
IGL01991:Als2cl APN 9 110892917 missense probably benign 0.00
IGL02073:Als2cl APN 9 110894339 missense probably benign
IGL02407:Als2cl APN 9 110889227 nonsense probably null
IGL03266:Als2cl APN 9 110890856 missense possibly damaging 0.74
R0127:Als2cl UTSW 9 110891867 missense probably damaging 1.00
R0395:Als2cl UTSW 9 110898084 missense probably damaging 1.00
R0490:Als2cl UTSW 9 110895346 missense probably benign 0.04
R0540:Als2cl UTSW 9 110895784 nonsense probably null
R0900:Als2cl UTSW 9 110890428 missense possibly damaging 0.94
R1542:Als2cl UTSW 9 110894034 missense probably benign 0.36
R1574:Als2cl UTSW 9 110884060 missense probably damaging 1.00
R1574:Als2cl UTSW 9 110884060 missense probably damaging 1.00
R2059:Als2cl UTSW 9 110885438 missense probably benign 0.00
R2168:Als2cl UTSW 9 110888742 missense probably damaging 1.00
R2851:Als2cl UTSW 9 110894135 missense probably damaging 0.99
R2853:Als2cl UTSW 9 110894135 missense probably damaging 0.99
R2919:Als2cl UTSW 9 110897499 critical splice acceptor site probably null
R3761:Als2cl UTSW 9 110898134 missense probably damaging 1.00
R3848:Als2cl UTSW 9 110889309 splice site probably benign
R3850:Als2cl UTSW 9 110889309 splice site probably benign
R4110:Als2cl UTSW 9 110884047 missense probably benign 0.18
R4438:Als2cl UTSW 9 110885398 missense probably damaging 0.98
R4732:Als2cl UTSW 9 110889136 missense probably damaging 0.99
R4733:Als2cl UTSW 9 110889136 missense probably damaging 0.99
R5060:Als2cl UTSW 9 110884137 missense probably damaging 0.99
R5119:Als2cl UTSW 9 110890819 missense probably damaging 1.00
R5905:Als2cl UTSW 9 110898084 missense probably damaging 1.00
R5913:Als2cl UTSW 9 110889705 critical splice acceptor site probably null
R5930:Als2cl UTSW 9 110887364 missense probably damaging 1.00
R6197:Als2cl UTSW 9 110895884 missense probably damaging 1.00
R6362:Als2cl UTSW 9 110895446 intron probably null
R7052:Als2cl UTSW 9 110898083 missense probably damaging 1.00
R7081:Als2cl UTSW 9 110894582 missense possibly damaging 0.66
R7472:Als2cl UTSW 9 110898106 missense probably benign 0.05
X0011:Als2cl UTSW 9 110885011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCTCACAGCATGGTGCAAACTC -3'
(R):5'- CACACTGACCAAGCTCTGATCCTG -3'

Sequencing Primer
(F):5'- ATGGTGCAAACTCCCTTTGG -3'
(R):5'- CTTGAGTCAGAGGCATCGGAC -3'
Posted On2013-05-29