Incidental Mutation 'R5560:Scn5a'
ID436539
Institutional Source Beutler Lab
Gene Symbol Scn5a
Ensembl Gene ENSMUSG00000032511
Gene Namesodium channel, voltage-gated, type V, alpha
SynonymsNav1.5c, Nav1.5, mH1, SkM2
MMRRC Submission 043117-MU
Accession Numbers

Ncbi RefSeq: NM_021544.4, NM_001253860.1; MGI:98251

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5560 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location119483408-119579016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 119560286 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 123 (A123E)
Ref Sequence ENSEMBL: ENSMUSP00000113272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065196] [ENSMUST00000117911] [ENSMUST00000120420] [ENSMUST00000138934]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065196
AA Change: A123E

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000066228
Gene: ENSMUSG00000032511
AA Change: A123E

DomainStartEndE-ValueType
Pfam:Ion_trans 130 423 2.4e-82 PFAM
Pfam:Na_trans_cytopl 478 667 5.2e-49 PFAM
Pfam:Ion_trans 716 950 1.1e-54 PFAM
Pfam:Na_trans_assoc 955 1203 2.9e-57 PFAM
Pfam:Ion_trans 1207 1484 2e-66 PFAM
Pfam:Ion_trans 1530 1786 7.2e-55 PFAM
Pfam:PKD_channel 1627 1780 3.5e-7 PFAM
IQ 1903 1925 5e-2 SMART
low complexity region 1961 1983 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117911
AA Change: A123E

PolyPhen 2 Score 0.260 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112838
Gene: ENSMUSG00000032511
AA Change: A123E

DomainStartEndE-ValueType
Pfam:Ion_trans 159 412 9.6e-76 PFAM
coiled coil region 413 451 N/A INTRINSIC
Pfam:DUF3451 461 668 4.9e-44 PFAM
Pfam:Ion_trans 751 940 2.3e-46 PFAM
Pfam:Na_trans_assoc 955 1218 1.2e-73 PFAM
Pfam:Ion_trans 1244 1472 2e-56 PFAM
PDB:1BYY|A 1474 1526 5e-29 PDB
Pfam:Ion_trans 1565 1774 1.5e-49 PFAM
Pfam:PKD_channel 1627 1781 2.6e-10 PFAM
IQ 1903 1925 5e-2 SMART
low complexity region 1961 1983 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120420
AA Change: A123E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113272
Gene: ENSMUSG00000032511
AA Change: A123E

DomainStartEndE-ValueType
Pfam:Ion_trans 159 412 4.5e-75 PFAM
coiled coil region 413 451 N/A INTRINSIC
Pfam:DUF3451 461 668 7.4e-43 PFAM
Pfam:Ion_trans 751 940 1.2e-45 PFAM
Pfam:Na_trans_assoc 955 1217 1.6e-72 PFAM
Pfam:Ion_trans 1243 1471 1.1e-55 PFAM
PDB:1BYY|A 1473 1525 5e-29 PDB
Pfam:Ion_trans 1564 1773 8.2e-49 PFAM
Pfam:PKD_channel 1626 1780 2.6e-9 PFAM
IQ 1902 1924 5e-2 SMART
low complexity region 1960 1982 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138934
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype Strain: 2179753; 3765977
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane protein and tetrodotoxin-resistant voltage-gated sodium channel subunit. This protein is found primarily in cardiac muscle and is responsible for the initial upstroke of the action potential in an electrocardiogram. Defects in this gene are a cause of long QT syndrome type 3 (LQT3), an autosomal dominant cardiac disease. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene die prenatally usually during organogenesis and may display decreased embryo size and abnormal cardiovascular system physiology. Heterozygous mice typically display abnormal heartbeats and defects in the function of the impulse conduction system. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(9) Gene trapped(2)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adipor1 T C 1: 134,426,040 W188R possibly damaging Het
Agrn T C 4: 156,178,497 D441G probably damaging Het
Ankrd55 T C 13: 112,383,490 S570P probably benign Het
Ano9 C G 7: 141,110,482 G80R probably damaging Het
Arhgef2 T A 3: 88,634,437 V250E probably damaging Het
Atp2b2 T C 6: 113,774,358 D583G possibly damaging Het
Bcar3 T A 3: 122,426,575 D40E possibly damaging Het
Capn12 A G 7: 28,882,860 D133G probably benign Het
Ccna1 A T 3: 55,048,569 Y269N probably damaging Het
Cct6b A T 11: 82,741,413 Y250N probably damaging Het
Cep112 A C 11: 108,437,235 K98Q probably damaging Het
Chst13 T C 6: 90,318,269 D54G probably damaging Het
Clstn2 G T 9: 97,469,819 H518N possibly damaging Het
Cntnap1 T A 11: 101,182,435 L581M probably damaging Het
Cog3 T A 14: 75,729,393 M446L probably damaging Het
D430042O09Rik T C 7: 125,854,561 V1150A probably benign Het
Dennd2c T A 3: 103,161,555 I756K probably damaging Het
Dennd3 T G 15: 73,532,895 L273R probably damaging Het
Dhx34 C A 7: 16,218,541 R53L probably benign Het
Dnah9 G A 11: 65,881,740 T3722I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dusp6 A G 10: 99,266,241 Y217C probably damaging Het
Dyrk1b G A 7: 28,184,253 R178Q possibly damaging Het
Eif4g1 T A 16: 20,686,895 C1009S probably benign Het
Fam198a T C 9: 121,978,223 F478L possibly damaging Het
Frmpd1 A T 4: 45,243,697 T57S probably damaging Het
Gjc2 A G 11: 59,177,359 V99A possibly damaging Het
Gm9955 A T 18: 24,709,092 probably benign Het
Gpr158 A G 2: 21,826,290 I734V possibly damaging Het
Herc1 A T 9: 66,451,119 H2494L probably benign Het
Hist1h1c A G 13: 23,739,407 S187G probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmgcs1 A G 13: 119,699,815 probably null Het
Invs A T 4: 48,416,084 T655S probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Kcnj6 A T 16: 94,832,965 L96M probably benign Het
Lfng A G 5: 140,614,267 D354G possibly damaging Het
Lgsn T C 1: 31,196,872 L139P probably damaging Het
Madd C A 2: 91,163,545 V923L probably damaging Het
Mfsd7a A T 5: 108,448,863 M1K probably null Het
Mical1 A T 10: 41,478,965 I157F probably damaging Het
Mis18bp1 T C 12: 65,152,816 N154S possibly damaging Het
Mrps14 A G 1: 160,195,535 K6R probably benign Het
Mug1 T A 6: 121,861,073 C421S probably damaging Het
Myo18b A G 5: 112,868,295 I696T probably damaging Het
Naf1 T C 8: 66,883,545 Y375H probably damaging Het
Nsf T A 11: 103,863,255 E485V possibly damaging Het
Nup188 A G 2: 30,309,885 D307G probably damaging Het
Ocel1 C A 8: 71,372,478 P108T probably damaging Het
Oip5 A G 2: 119,613,059 S177P probably damaging Het
Olfr1436 G A 19: 12,298,644 Q163* probably null Het
Olfr365 A G 2: 37,201,930 I230V probably benign Het
Olfr51 A C 11: 51,007,523 I184L possibly damaging Het
Olfr943 A C 9: 39,184,184 E2A probably benign Het
Omg A G 11: 79,501,758 W425R possibly damaging Het
Pikfyve A G 1: 65,253,407 Y1339C probably damaging Het
Polr3e A G 7: 120,922,949 D6G possibly damaging Het
Pou4f3 C A 18: 42,395,415 P141Q probably benign Het
Rcsd1 T A 1: 165,655,501 N337I possibly damaging Het
Rhoj C T 12: 75,391,712 P91S probably damaging Het
Rnf10 A G 5: 115,249,998 F367S probably damaging Het
Rnft1 A T 11: 86,493,196 R307S probably benign Het
Ryr3 A T 2: 112,754,877 F2788Y probably damaging Het
Scgb1c1 A G 7: 140,846,224 K78E possibly damaging Het
Setd2 T A 9: 110,549,839 Y623* probably null Het
Tbl2 C T 5: 135,157,591 Q216* probably null Het
Thegl A G 5: 77,016,486 D112G possibly damaging Het
Tnc A G 4: 64,008,709 I860T probably damaging Het
Trafd1 T C 5: 121,373,303 K484R possibly damaging Het
Trank1 T C 9: 111,390,567 V2124A probably damaging Het
Trpm4 A T 7: 45,310,332 W713R probably damaging Het
Uap1l1 T C 2: 25,362,676 T451A probably benign Het
Uba6 A T 5: 86,131,260 C668S probably damaging Het
Ubxn11 T C 4: 134,126,624 F441S probably damaging Het
Vmn1r22 C T 6: 57,900,738 V85M probably damaging Het
Vmn2r72 T A 7: 85,751,942 I90L probably damaging Het
Wdr60 T C 12: 116,218,113 S769G probably damaging Het
Zfp330 T C 8: 82,764,956 E196G probably benign Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp994 T C 17: 22,201,713 E85G possibly damaging Het
Other mutations in Scn5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Scn5a APN 9 119486224 missense probably damaging 1.00
IGL00480:Scn5a APN 9 119517538 missense possibly damaging 0.73
IGL00542:Scn5a APN 9 119492126 missense probably damaging 1.00
IGL00852:Scn5a APN 9 119537682 missense probably benign 0.26
IGL00895:Scn5a APN 9 119513104 splice site probably null
IGL00905:Scn5a APN 9 119536501 missense probably damaging 1.00
IGL01347:Scn5a APN 9 119562441 nonsense probably null
IGL01396:Scn5a APN 9 119534704 missense probably damaging 0.98
IGL01402:Scn5a APN 9 119486470 missense probably damaging 1.00
IGL01404:Scn5a APN 9 119486470 missense probably damaging 1.00
IGL01487:Scn5a APN 9 119562623 start codon destroyed probably null 0.90
IGL01612:Scn5a APN 9 119486025 missense possibly damaging 0.86
IGL02134:Scn5a APN 9 119485892 missense probably damaging 0.98
IGL02434:Scn5a APN 9 119533793 missense possibly damaging 0.83
IGL02698:Scn5a APN 9 119521097 missense probably damaging 1.00
IGL02717:Scn5a APN 9 119529010 missense probably benign 0.12
IGL02746:Scn5a APN 9 119550637 missense probably damaging 1.00
IGL02951:Scn5a APN 9 119495685 missense probably damaging 1.00
IGL03155:Scn5a APN 9 119512182 missense possibly damaging 0.74
IGL03188:Scn5a APN 9 119522566 missense probably damaging 1.00
IGL03268:Scn5a APN 9 119521231 missense probably damaging 1.00
IGL03287:Scn5a APN 9 119489778 missense probably damaging 1.00
IGL03328:Scn5a APN 9 119537636 missense probably benign 0.12
PIT4142001:Scn5a UTSW 9 119486258 missense probably damaging 1.00
PIT4520001:Scn5a UTSW 9 119534570 missense possibly damaging 0.56
R0026:Scn5a UTSW 9 119522566 missense probably damaging 1.00
R0044:Scn5a UTSW 9 119492047 critical splice donor site probably null
R0044:Scn5a UTSW 9 119492047 critical splice donor site probably null
R0267:Scn5a UTSW 9 119543135 missense probably damaging 0.98
R0313:Scn5a UTSW 9 119534571 missense probably damaging 1.00
R0360:Scn5a UTSW 9 119522599 missense probably damaging 0.99
R0364:Scn5a UTSW 9 119522599 missense probably damaging 0.99
R0369:Scn5a UTSW 9 119533772 missense probably damaging 0.99
R0512:Scn5a UTSW 9 119550658 missense probably damaging 1.00
R0681:Scn5a UTSW 9 119539640 missense probably damaging 0.96
R1163:Scn5a UTSW 9 119533927 missense probably damaging 1.00
R1469:Scn5a UTSW 9 119533661 critical splice donor site probably null
R1469:Scn5a UTSW 9 119533661 critical splice donor site probably null
R1470:Scn5a UTSW 9 119536475 missense possibly damaging 0.82
R1470:Scn5a UTSW 9 119536475 missense possibly damaging 0.82
R1530:Scn5a UTSW 9 119495562 missense probably damaging 1.00
R1532:Scn5a UTSW 9 119533847 missense probably damaging 1.00
R1544:Scn5a UTSW 9 119486633 missense probably damaging 1.00
R1588:Scn5a UTSW 9 119521301 missense probably damaging 1.00
R1597:Scn5a UTSW 9 119562497 missense probably damaging 0.99
R1607:Scn5a UTSW 9 119486092 missense probably damaging 1.00
R1657:Scn5a UTSW 9 119562380 missense probably damaging 1.00
R1664:Scn5a UTSW 9 119521177 missense possibly damaging 0.84
R1785:Scn5a UTSW 9 119521129 missense probably damaging 1.00
R1925:Scn5a UTSW 9 119529019 missense probably benign
R1956:Scn5a UTSW 9 119517413 missense possibly damaging 0.82
R2006:Scn5a UTSW 9 119536480 missense probably damaging 1.00
R2061:Scn5a UTSW 9 119485651 missense probably damaging 0.98
R2083:Scn5a UTSW 9 119492123 missense probably benign 0.45
R2180:Scn5a UTSW 9 119516051 missense probably benign
R2216:Scn5a UTSW 9 119485612 missense probably benign 0.37
R2216:Scn5a UTSW 9 119513085 missense probably benign
R2320:Scn5a UTSW 9 119529956 critical splice donor site probably null
R2377:Scn5a UTSW 9 119539727 missense probably damaging 1.00
R2510:Scn5a UTSW 9 119533685 missense probably benign 0.05
R3113:Scn5a UTSW 9 119485672 missense probably damaging 1.00
R3769:Scn5a UTSW 9 119552076 critical splice acceptor site probably benign
R4133:Scn5a UTSW 9 119486372 missense probably damaging 1.00
R4164:Scn5a UTSW 9 119495778 missense probably damaging 1.00
R4447:Scn5a UTSW 9 119550627 missense probably damaging 1.00
R4635:Scn5a UTSW 9 119528985 missense possibly damaging 0.47
R4734:Scn5a UTSW 9 119539538 missense probably damaging 0.98
R4829:Scn5a UTSW 9 119534707 missense probably benign 0.00
R4867:Scn5a UTSW 9 119550671 nonsense probably null
R5055:Scn5a UTSW 9 119522566 missense probably damaging 1.00
R5229:Scn5a UTSW 9 119535976 missense probably damaging 1.00
R5344:Scn5a UTSW 9 119534007 missense probably benign 0.25
R5424:Scn5a UTSW 9 119501734 missense probably damaging 1.00
R5517:Scn5a UTSW 9 119495713 missense probably damaging 1.00
R5526:Scn5a UTSW 9 119521171 missense probably damaging 1.00
R5719:Scn5a UTSW 9 119530052 missense possibly damaging 0.91
R5726:Scn5a UTSW 9 119533847 missense probably damaging 1.00
R5800:Scn5a UTSW 9 119501666 missense probably damaging 1.00
R5826:Scn5a UTSW 9 119521333 missense probably damaging 1.00
R6046:Scn5a UTSW 9 119562374 missense probably damaging 1.00
R6101:Scn5a UTSW 9 119522650 missense probably damaging 0.98
R6162:Scn5a UTSW 9 119522555 missense probably damaging 0.98
R6375:Scn5a UTSW 9 119543356 missense probably damaging 1.00
R6378:Scn5a UTSW 9 119486036 missense probably damaging 1.00
R6464:Scn5a UTSW 9 119534580 missense probably damaging 1.00
R6794:Scn5a UTSW 9 119535889 missense probably damaging 0.98
R6799:Scn5a UTSW 9 119495622 missense possibly damaging 0.62
R6850:Scn5a UTSW 9 119501749 missense possibly damaging 0.92
R6858:Scn5a UTSW 9 119492090 missense probably benign 0.11
R6861:Scn5a UTSW 9 119530023 missense probably damaging 1.00
R6875:Scn5a UTSW 9 119486644 missense probably damaging 1.00
R6989:Scn5a UTSW 9 119486329 missense probably damaging 1.00
R7009:Scn5a UTSW 9 119485930 missense probably damaging 1.00
R7064:Scn5a UTSW 9 119489911 missense probably damaging 0.99
R7145:Scn5a UTSW 9 119486371 missense probably damaging 1.00
R7212:Scn5a UTSW 9 119543385 missense possibly damaging 0.94
R7238:Scn5a UTSW 9 119491544 missense possibly damaging 0.73
R7266:Scn5a UTSW 9 119562560 missense probably benign 0.37
R7348:Scn5a UTSW 9 119535833 missense probably benign 0.00
R7399:Scn5a UTSW 9 119486530 missense probably damaging 1.00
R7453:Scn5a UTSW 9 119522590 missense possibly damaging 0.82
R7495:Scn5a UTSW 9 119543134 missense probably damaging 0.99
R7681:Scn5a UTSW 9 119529977 missense probably benign 0.01
R7729:Scn5a UTSW 9 119495540 missense probably damaging 1.00
R7791:Scn5a UTSW 9 119543336 missense possibly damaging 0.47
R7794:Scn5a UTSW 9 119529087 missense probably damaging 0.99
R7873:Scn5a UTSW 9 119498127 missense probably damaging 1.00
R7956:Scn5a UTSW 9 119498127 missense probably damaging 1.00
X0023:Scn5a UTSW 9 119517769 missense probably damaging 1.00
X0065:Scn5a UTSW 9 119485669 missense probably damaging 1.00
Z1177:Scn5a UTSW 9 119522518 missense probably damaging 1.00
Z1177:Scn5a UTSW 9 119533931 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTGAGGGTGGAGGTCACTAC -3'
(R):5'- ATAAGTCTCTGCTGCCCCAG -3'

Sequencing Primer
(F):5'- TCACTACCGGCCACTAGTG -3'
(R):5'- AGGGCTCTCTGTTGCAGCTC -3'
Posted On2016-10-24