Incidental Mutation 'R5560:Gjc2'
ID436545
Institutional Source Beutler Lab
Gene Symbol Gjc2
Ensembl Gene ENSMUSG00000043448
Gene Namegap junction protein, gamma 2
SynonymsB230382L12Rik, connexin 47, Gja12, Cx47
MMRRC Submission 043117-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5560 (G1)
Quality Score102
Status Not validated
Chromosome11
Chromosomal Location59175568-59183213 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59177359 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 99 (V99A)
Ref Sequence ENSEMBL: ENSMUSP00000104421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108790] [ENSMUST00000108793]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108790
AA Change: V99A

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104418
Gene: ENSMUSG00000043448
AA Change: V99A

DomainStartEndE-ValueType
CNX 45 78 3.37e-17 SMART
low complexity region 101 127 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 143 193 N/A INTRINSIC
Connexin_CCC 222 288 9.88e-42 SMART
low complexity region 298 330 N/A INTRINSIC
low complexity region 347 372 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108793
AA Change: V99A

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104421
Gene: ENSMUSG00000043448
AA Change: V99A

DomainStartEndE-ValueType
CNX 45 78 3.37e-17 SMART
low complexity region 101 127 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 143 193 N/A INTRINSIC
Connexin_CCC 222 288 9.88e-42 SMART
low complexity region 298 330 N/A INTRINSIC
low complexity region 347 372 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gap junction protein. Gap junction proteins are members of a large family of homologous connexins and comprise 4 transmembrane, 2 extracellular, and 3 cytoplasmic domains. This gene plays a key role in central myelination and is involved in peripheral myelination in humans. Defects in this gene are the cause of autosomal recessive Pelizaeus-Merzbacher-like disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one null allele are viable and behaviorally normal with no CNS demyelination detected in the spinal cord. In contrast, mice homozygous for a different null allele display a conspicuous vacuolation of CNS nerve fibers, especially in the myelinated region of the optic nerve. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adipor1 T C 1: 134,426,040 W188R possibly damaging Het
Agrn T C 4: 156,178,497 D441G probably damaging Het
Ankrd55 T C 13: 112,383,490 S570P probably benign Het
Ano9 C G 7: 141,110,482 G80R probably damaging Het
Arhgef2 T A 3: 88,634,437 V250E probably damaging Het
Atp2b2 T C 6: 113,774,358 D583G possibly damaging Het
Bcar3 T A 3: 122,426,575 D40E possibly damaging Het
Capn12 A G 7: 28,882,860 D133G probably benign Het
Ccna1 A T 3: 55,048,569 Y269N probably damaging Het
Cct6b A T 11: 82,741,413 Y250N probably damaging Het
Cep112 A C 11: 108,437,235 K98Q probably damaging Het
Chst13 T C 6: 90,318,269 D54G probably damaging Het
Clstn2 G T 9: 97,469,819 H518N possibly damaging Het
Cntnap1 T A 11: 101,182,435 L581M probably damaging Het
Cog3 T A 14: 75,729,393 M446L probably damaging Het
D430042O09Rik T C 7: 125,854,561 V1150A probably benign Het
Dennd2c T A 3: 103,161,555 I756K probably damaging Het
Dennd3 T G 15: 73,532,895 L273R probably damaging Het
Dhx34 C A 7: 16,218,541 R53L probably benign Het
Dnah9 G A 11: 65,881,740 T3722I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dusp6 A G 10: 99,266,241 Y217C probably damaging Het
Dyrk1b G A 7: 28,184,253 R178Q possibly damaging Het
Eif4g1 T A 16: 20,686,895 C1009S probably benign Het
Fam198a T C 9: 121,978,223 F478L possibly damaging Het
Frmpd1 A T 4: 45,243,697 T57S probably damaging Het
Gm9955 A T 18: 24,709,092 probably benign Het
Gpr158 A G 2: 21,826,290 I734V possibly damaging Het
Herc1 A T 9: 66,451,119 H2494L probably benign Het
Hist1h1c A G 13: 23,739,407 S187G probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmgcs1 A G 13: 119,699,815 probably null Het
Invs A T 4: 48,416,084 T655S probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Kcnj6 A T 16: 94,832,965 L96M probably benign Het
Lfng A G 5: 140,614,267 D354G possibly damaging Het
Lgsn T C 1: 31,196,872 L139P probably damaging Het
Madd C A 2: 91,163,545 V923L probably damaging Het
Mfsd7a A T 5: 108,448,863 M1K probably null Het
Mical1 A T 10: 41,478,965 I157F probably damaging Het
Mis18bp1 T C 12: 65,152,816 N154S possibly damaging Het
Mrps14 A G 1: 160,195,535 K6R probably benign Het
Mug1 T A 6: 121,861,073 C421S probably damaging Het
Myo18b A G 5: 112,868,295 I696T probably damaging Het
Naf1 T C 8: 66,883,545 Y375H probably damaging Het
Nsf T A 11: 103,863,255 E485V possibly damaging Het
Nup188 A G 2: 30,309,885 D307G probably damaging Het
Ocel1 C A 8: 71,372,478 P108T probably damaging Het
Oip5 A G 2: 119,613,059 S177P probably damaging Het
Olfr1436 G A 19: 12,298,644 Q163* probably null Het
Olfr365 A G 2: 37,201,930 I230V probably benign Het
Olfr51 A C 11: 51,007,523 I184L possibly damaging Het
Olfr943 A C 9: 39,184,184 E2A probably benign Het
Omg A G 11: 79,501,758 W425R possibly damaging Het
Pikfyve A G 1: 65,253,407 Y1339C probably damaging Het
Polr3e A G 7: 120,922,949 D6G possibly damaging Het
Pou4f3 C A 18: 42,395,415 P141Q probably benign Het
Rcsd1 T A 1: 165,655,501 N337I possibly damaging Het
Rhoj C T 12: 75,391,712 P91S probably damaging Het
Rnf10 A G 5: 115,249,998 F367S probably damaging Het
Rnft1 A T 11: 86,493,196 R307S probably benign Het
Ryr3 A T 2: 112,754,877 F2788Y probably damaging Het
Scgb1c1 A G 7: 140,846,224 K78E possibly damaging Het
Scn5a G T 9: 119,560,286 A123E probably damaging Het
Setd2 T A 9: 110,549,839 Y623* probably null Het
Tbl2 C T 5: 135,157,591 Q216* probably null Het
Thegl A G 5: 77,016,486 D112G possibly damaging Het
Tnc A G 4: 64,008,709 I860T probably damaging Het
Trafd1 T C 5: 121,373,303 K484R possibly damaging Het
Trank1 T C 9: 111,390,567 V2124A probably damaging Het
Trpm4 A T 7: 45,310,332 W713R probably damaging Het
Uap1l1 T C 2: 25,362,676 T451A probably benign Het
Uba6 A T 5: 86,131,260 C668S probably damaging Het
Ubxn11 T C 4: 134,126,624 F441S probably damaging Het
Vmn1r22 C T 6: 57,900,738 V85M probably damaging Het
Vmn2r72 T A 7: 85,751,942 I90L probably damaging Het
Wdr60 T C 12: 116,218,113 S769G probably damaging Het
Zfp330 T C 8: 82,764,956 E196G probably benign Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp994 T C 17: 22,201,713 E85G possibly damaging Het
Other mutations in Gjc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Gjc2 APN 11 59177518 missense probably damaging 1.00
IGL02191:Gjc2 APN 11 59177560 missense probably damaging 0.99
FR4342:Gjc2 UTSW 11 59182743 unclassified probably benign
R0086:Gjc2 UTSW 11 59176846 missense probably benign 0.39
R0201:Gjc2 UTSW 11 59177590 missense possibly damaging 0.79
R1478:Gjc2 UTSW 11 59177608 missense possibly damaging 0.66
R5211:Gjc2 UTSW 11 59177458 missense possibly damaging 0.77
R5395:Gjc2 UTSW 11 59177489 missense possibly damaging 0.95
R5906:Gjc2 UTSW 11 59176841 missense probably benign 0.39
R6909:Gjc2 UTSW 11 59177092 missense unknown
R7055:Gjc2 UTSW 11 59177030 missense unknown
R7241:Gjc2 UTSW 11 59177134 missense unknown
Z1177:Gjc2 UTSW 11 59177617 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCGAAGCCGTACAGTAG -3'
(R):5'- GTCTTCCGCATTGTGCTGAC -3'

Sequencing Primer
(F):5'- AGGAGTGACCACCGTCTTG -3'
(R):5'- ATTGTGCTGACAGCCGTC -3'
Posted On2016-10-24