Incidental Mutation 'R5560:Cct6b'
ID 436548
Institutional Source Beutler Lab
Gene Symbol Cct6b
Ensembl Gene ENSMUSG00000020698
Gene Name chaperonin containing TCP1 subunit 6B
Synonyms CCTzeta-2, Cctz-2
MMRRC Submission 043117-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.358) question?
Stock # R5560 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 82610076-82655147 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 82632239 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 250 (Y250N)
Ref Sequence ENSEMBL: ENSMUSP00000021040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021040] [ENSMUST00000100722]
AlphaFold Q61390
Predicted Effect probably damaging
Transcript: ENSMUST00000021040
AA Change: Y250N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021040
Gene: ENSMUSG00000020698
AA Change: Y250N

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 30 526 1.1e-161 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100722
AA Change: Y211N

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098288
Gene: ENSMUSG00000020698
AA Change: Y211N

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 4 486 9.7e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120047
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a molecular chaperone that is a member of the chaperonin-containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adipor1 T C 1: 134,353,778 (GRCm39) W188R possibly damaging Het
Agrn T C 4: 156,262,954 (GRCm39) D441G probably damaging Het
Ankrd55 T C 13: 112,520,024 (GRCm39) S570P probably benign Het
Ano9 C G 7: 140,690,395 (GRCm39) G80R probably damaging Het
Arhgef2 T A 3: 88,541,744 (GRCm39) V250E probably damaging Het
Atp2b2 T C 6: 113,751,319 (GRCm39) D583G possibly damaging Het
Bcar3 T A 3: 122,220,224 (GRCm39) D40E possibly damaging Het
Capn12 A G 7: 28,582,285 (GRCm39) D133G probably benign Het
Ccna1 A T 3: 54,955,990 (GRCm39) Y269N probably damaging Het
Cep112 A C 11: 108,328,061 (GRCm39) K98Q probably damaging Het
Chst13 T C 6: 90,295,251 (GRCm39) D54G probably damaging Het
Clstn2 G T 9: 97,351,872 (GRCm39) H518N possibly damaging Het
Cntnap1 T A 11: 101,073,261 (GRCm39) L581M probably damaging Het
Cog3 T A 14: 75,966,833 (GRCm39) M446L probably damaging Het
Dennd2c T A 3: 103,068,871 (GRCm39) I756K probably damaging Het
Dennd3 T G 15: 73,404,744 (GRCm39) L273R probably damaging Het
Dhx34 C A 7: 15,952,466 (GRCm39) R53L probably benign Het
Dnah9 G A 11: 65,772,566 (GRCm39) T3722I probably benign Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Dusp6 A G 10: 99,102,103 (GRCm39) Y217C probably damaging Het
Dync2i1 T C 12: 116,181,733 (GRCm39) S769G probably damaging Het
Dyrk1b G A 7: 27,883,678 (GRCm39) R178Q possibly damaging Het
Eif4g1 T A 16: 20,505,645 (GRCm39) C1009S probably benign Het
Frmpd1 A T 4: 45,243,697 (GRCm39) T57S probably damaging Het
Gask1a T C 9: 121,807,289 (GRCm39) F478L possibly damaging Het
Gjc2 A G 11: 59,068,185 (GRCm39) V99A possibly damaging Het
Gm9955 A T 18: 24,842,149 (GRCm39) probably benign Het
Gpr158 A G 2: 21,831,101 (GRCm39) I734V possibly damaging Het
H1f2 A G 13: 23,923,390 (GRCm39) S187G probably benign Het
Herc1 A T 9: 66,358,401 (GRCm39) H2494L probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmgcs1 A G 13: 120,161,351 (GRCm39) probably null Het
Invs A T 4: 48,416,084 (GRCm39) T655S probably benign Het
Ipo9 G A 1: 135,329,983 (GRCm39) L486F probably damaging Het
Katnip T C 7: 125,453,733 (GRCm39) V1150A probably benign Het
Kcnj6 A T 16: 94,633,824 (GRCm39) L96M probably benign Het
Lfng A G 5: 140,600,022 (GRCm39) D354G possibly damaging Het
Lgsn T C 1: 31,235,953 (GRCm39) L139P probably damaging Het
Madd C A 2: 90,993,890 (GRCm39) V923L probably damaging Het
Mical1 A T 10: 41,354,961 (GRCm39) I157F probably damaging Het
Mis18bp1 T C 12: 65,199,590 (GRCm39) N154S possibly damaging Het
Mrps14 A G 1: 160,023,105 (GRCm39) K6R probably benign Het
Mug1 T A 6: 121,838,032 (GRCm39) C421S probably damaging Het
Myo18b A G 5: 113,016,161 (GRCm39) I696T probably damaging Het
Naf1 T C 8: 67,336,197 (GRCm39) Y375H probably damaging Het
Nsf T A 11: 103,754,081 (GRCm39) E485V possibly damaging Het
Nup188 A G 2: 30,199,897 (GRCm39) D307G probably damaging Het
Ocel1 C A 8: 71,825,122 (GRCm39) P108T probably damaging Het
Oip5 A G 2: 119,443,540 (GRCm39) S177P probably damaging Het
Omg A G 11: 79,392,584 (GRCm39) W425R possibly damaging Het
Or1ad8 A C 11: 50,898,350 (GRCm39) I184L possibly damaging Het
Or1l4 A G 2: 37,091,942 (GRCm39) I230V probably benign Het
Or5an10 G A 19: 12,276,008 (GRCm39) Q163* probably null Het
Or8g26 A C 9: 39,095,480 (GRCm39) E2A probably benign Het
Pikfyve A G 1: 65,292,566 (GRCm39) Y1339C probably damaging Het
Polr3e A G 7: 120,522,172 (GRCm39) D6G possibly damaging Het
Pou4f3 C A 18: 42,528,480 (GRCm39) P141Q probably benign Het
Rcsd1 T A 1: 165,483,070 (GRCm39) N337I possibly damaging Het
Rhoj C T 12: 75,438,486 (GRCm39) P91S probably damaging Het
Rnf10 A G 5: 115,388,057 (GRCm39) F367S probably damaging Het
Rnft1 A T 11: 86,384,022 (GRCm39) R307S probably benign Het
Ryr3 A T 2: 112,585,222 (GRCm39) F2788Y probably damaging Het
Scgb1c1 A G 7: 140,426,137 (GRCm39) K78E possibly damaging Het
Scn5a G T 9: 119,389,352 (GRCm39) A123E probably damaging Het
Setd2 T A 9: 110,378,907 (GRCm39) Y623* probably null Het
Slc49a3 A T 5: 108,596,729 (GRCm39) M1K probably null Het
Spmap2l A G 5: 77,164,333 (GRCm39) D112G possibly damaging Het
Tbl2 C T 5: 135,186,445 (GRCm39) Q216* probably null Het
Tnc A G 4: 63,926,946 (GRCm39) I860T probably damaging Het
Trafd1 T C 5: 121,511,366 (GRCm39) K484R possibly damaging Het
Trank1 T C 9: 111,219,635 (GRCm39) V2124A probably damaging Het
Trpm4 A T 7: 44,959,756 (GRCm39) W713R probably damaging Het
Uap1l1 T C 2: 25,252,688 (GRCm39) T451A probably benign Het
Uba6 A T 5: 86,279,119 (GRCm39) C668S probably damaging Het
Ubxn11 T C 4: 133,853,935 (GRCm39) F441S probably damaging Het
Vmn1r22 C T 6: 57,877,723 (GRCm39) V85M probably damaging Het
Vmn2r72 T A 7: 85,401,150 (GRCm39) I90L probably damaging Het
Zfp330 T C 8: 83,491,585 (GRCm39) E196G probably benign Het
Zfp746 A G 6: 48,059,108 (GRCm39) V167A possibly damaging Het
Zfp994 T C 17: 22,420,694 (GRCm39) E85G possibly damaging Het
Other mutations in Cct6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Cct6b APN 11 82,632,217 (GRCm39) missense probably damaging 1.00
IGL02606:Cct6b APN 11 82,627,271 (GRCm39) missense probably damaging 1.00
IGL02707:Cct6b APN 11 82,645,780 (GRCm39) splice site probably benign
IGL03081:Cct6b APN 11 82,654,995 (GRCm39) nonsense probably null
R0032:Cct6b UTSW 11 82,644,469 (GRCm39) missense possibly damaging 0.87
R0395:Cct6b UTSW 11 82,630,506 (GRCm39) missense probably benign
R0556:Cct6b UTSW 11 82,610,270 (GRCm39) splice site probably benign
R0631:Cct6b UTSW 11 82,627,914 (GRCm39) splice site probably null
R1456:Cct6b UTSW 11 82,644,446 (GRCm39) splice site probably benign
R3713:Cct6b UTSW 11 82,651,183 (GRCm39) missense probably damaging 1.00
R4791:Cct6b UTSW 11 82,632,830 (GRCm39) splice site probably null
R5154:Cct6b UTSW 11 82,630,521 (GRCm39) missense probably damaging 1.00
R5256:Cct6b UTSW 11 82,655,046 (GRCm39) missense probably damaging 0.98
R5338:Cct6b UTSW 11 82,653,015 (GRCm39) missense possibly damaging 0.94
R5455:Cct6b UTSW 11 82,645,943 (GRCm39) missense probably benign 0.04
R5616:Cct6b UTSW 11 82,632,175 (GRCm39) missense probably damaging 1.00
R5644:Cct6b UTSW 11 82,613,281 (GRCm39) missense probably benign 0.02
R6862:Cct6b UTSW 11 82,610,785 (GRCm39) missense probably damaging 1.00
R7960:Cct6b UTSW 11 82,632,221 (GRCm39) missense possibly damaging 0.94
R8240:Cct6b UTSW 11 82,614,650 (GRCm39) missense probably damaging 1.00
R8785:Cct6b UTSW 11 82,632,157 (GRCm39) missense probably damaging 1.00
R8943:Cct6b UTSW 11 82,654,959 (GRCm39) utr 5 prime probably benign
R9527:Cct6b UTSW 11 82,630,447 (GRCm39) critical splice donor site probably null
R9674:Cct6b UTSW 11 82,645,838 (GRCm39) missense probably damaging 1.00
X0060:Cct6b UTSW 11 82,632,136 (GRCm39) missense probably benign 0.00
Z1176:Cct6b UTSW 11 82,654,891 (GRCm39) start gained probably benign
Z1176:Cct6b UTSW 11 82,614,765 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGCACTTGAGCTGTCC -3'
(R):5'- GCGTGCCAATTTTGTCTTCG -3'

Sequencing Primer
(F):5'- GCTGTCCGCTTCTCTCTCAC -3'
(R):5'- CTAGTCCAGGATGGTCTCAAACATG -3'
Posted On 2016-10-24