Incidental Mutation 'R5560:Cct6b'
ID436548
Institutional Source Beutler Lab
Gene Symbol Cct6b
Ensembl Gene ENSMUSG00000020698
Gene Namechaperonin containing Tcp1, subunit 6b (zeta)
SynonymsCCTzeta-2, Cctz-2
MMRRC Submission 043117-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R5560 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location82719250-82764321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82741413 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 250 (Y250N)
Ref Sequence ENSEMBL: ENSMUSP00000021040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021040] [ENSMUST00000100722]
Predicted Effect probably damaging
Transcript: ENSMUST00000021040
AA Change: Y250N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021040
Gene: ENSMUSG00000020698
AA Change: Y250N

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 30 526 1.1e-161 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100722
AA Change: Y211N

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098288
Gene: ENSMUSG00000020698
AA Change: Y211N

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 4 486 9.7e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120047
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a molecular chaperone that is a member of the chaperonin-containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adipor1 T C 1: 134,426,040 W188R possibly damaging Het
Agrn T C 4: 156,178,497 D441G probably damaging Het
Ankrd55 T C 13: 112,383,490 S570P probably benign Het
Ano9 C G 7: 141,110,482 G80R probably damaging Het
Arhgef2 T A 3: 88,634,437 V250E probably damaging Het
Atp2b2 T C 6: 113,774,358 D583G possibly damaging Het
Bcar3 T A 3: 122,426,575 D40E possibly damaging Het
Capn12 A G 7: 28,882,860 D133G probably benign Het
Ccna1 A T 3: 55,048,569 Y269N probably damaging Het
Cep112 A C 11: 108,437,235 K98Q probably damaging Het
Chst13 T C 6: 90,318,269 D54G probably damaging Het
Clstn2 G T 9: 97,469,819 H518N possibly damaging Het
Cntnap1 T A 11: 101,182,435 L581M probably damaging Het
Cog3 T A 14: 75,729,393 M446L probably damaging Het
D430042O09Rik T C 7: 125,854,561 V1150A probably benign Het
Dennd2c T A 3: 103,161,555 I756K probably damaging Het
Dennd3 T G 15: 73,532,895 L273R probably damaging Het
Dhx34 C A 7: 16,218,541 R53L probably benign Het
Dnah9 G A 11: 65,881,740 T3722I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dusp6 A G 10: 99,266,241 Y217C probably damaging Het
Dyrk1b G A 7: 28,184,253 R178Q possibly damaging Het
Eif4g1 T A 16: 20,686,895 C1009S probably benign Het
Fam198a T C 9: 121,978,223 F478L possibly damaging Het
Frmpd1 A T 4: 45,243,697 T57S probably damaging Het
Gjc2 A G 11: 59,177,359 V99A possibly damaging Het
Gm9955 A T 18: 24,709,092 probably benign Het
Gpr158 A G 2: 21,826,290 I734V possibly damaging Het
Herc1 A T 9: 66,451,119 H2494L probably benign Het
Hist1h1c A G 13: 23,739,407 S187G probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmgcs1 A G 13: 119,699,815 probably null Het
Invs A T 4: 48,416,084 T655S probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Kcnj6 A T 16: 94,832,965 L96M probably benign Het
Lfng A G 5: 140,614,267 D354G possibly damaging Het
Lgsn T C 1: 31,196,872 L139P probably damaging Het
Madd C A 2: 91,163,545 V923L probably damaging Het
Mfsd7a A T 5: 108,448,863 M1K probably null Het
Mical1 A T 10: 41,478,965 I157F probably damaging Het
Mis18bp1 T C 12: 65,152,816 N154S possibly damaging Het
Mrps14 A G 1: 160,195,535 K6R probably benign Het
Mug1 T A 6: 121,861,073 C421S probably damaging Het
Myo18b A G 5: 112,868,295 I696T probably damaging Het
Naf1 T C 8: 66,883,545 Y375H probably damaging Het
Nsf T A 11: 103,863,255 E485V possibly damaging Het
Nup188 A G 2: 30,309,885 D307G probably damaging Het
Ocel1 C A 8: 71,372,478 P108T probably damaging Het
Oip5 A G 2: 119,613,059 S177P probably damaging Het
Olfr1436 G A 19: 12,298,644 Q163* probably null Het
Olfr365 A G 2: 37,201,930 I230V probably benign Het
Olfr51 A C 11: 51,007,523 I184L possibly damaging Het
Olfr943 A C 9: 39,184,184 E2A probably benign Het
Omg A G 11: 79,501,758 W425R possibly damaging Het
Pikfyve A G 1: 65,253,407 Y1339C probably damaging Het
Polr3e A G 7: 120,922,949 D6G possibly damaging Het
Pou4f3 C A 18: 42,395,415 P141Q probably benign Het
Rcsd1 T A 1: 165,655,501 N337I possibly damaging Het
Rhoj C T 12: 75,391,712 P91S probably damaging Het
Rnf10 A G 5: 115,249,998 F367S probably damaging Het
Rnft1 A T 11: 86,493,196 R307S probably benign Het
Ryr3 A T 2: 112,754,877 F2788Y probably damaging Het
Scgb1c1 A G 7: 140,846,224 K78E possibly damaging Het
Scn5a G T 9: 119,560,286 A123E probably damaging Het
Setd2 T A 9: 110,549,839 Y623* probably null Het
Tbl2 C T 5: 135,157,591 Q216* probably null Het
Thegl A G 5: 77,016,486 D112G possibly damaging Het
Tnc A G 4: 64,008,709 I860T probably damaging Het
Trafd1 T C 5: 121,373,303 K484R possibly damaging Het
Trank1 T C 9: 111,390,567 V2124A probably damaging Het
Trpm4 A T 7: 45,310,332 W713R probably damaging Het
Uap1l1 T C 2: 25,362,676 T451A probably benign Het
Uba6 A T 5: 86,131,260 C668S probably damaging Het
Ubxn11 T C 4: 134,126,624 F441S probably damaging Het
Vmn1r22 C T 6: 57,900,738 V85M probably damaging Het
Vmn2r72 T A 7: 85,751,942 I90L probably damaging Het
Wdr60 T C 12: 116,218,113 S769G probably damaging Het
Zfp330 T C 8: 82,764,956 E196G probably benign Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp994 T C 17: 22,201,713 E85G possibly damaging Het
Other mutations in Cct6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Cct6b APN 11 82741391 missense probably damaging 1.00
IGL02606:Cct6b APN 11 82736445 missense probably damaging 1.00
IGL02707:Cct6b APN 11 82754954 splice site probably benign
IGL03081:Cct6b APN 11 82764169 nonsense probably null
R0032:Cct6b UTSW 11 82753643 missense possibly damaging 0.87
R0395:Cct6b UTSW 11 82739680 missense probably benign
R0556:Cct6b UTSW 11 82719444 splice site probably benign
R0631:Cct6b UTSW 11 82737088 splice site probably null
R1456:Cct6b UTSW 11 82753620 splice site probably benign
R3713:Cct6b UTSW 11 82760357 missense probably damaging 1.00
R4791:Cct6b UTSW 11 82742004 splice site probably null
R5154:Cct6b UTSW 11 82739695 missense probably damaging 1.00
R5256:Cct6b UTSW 11 82764220 missense probably damaging 0.98
R5338:Cct6b UTSW 11 82762189 missense possibly damaging 0.94
R5455:Cct6b UTSW 11 82755117 missense probably benign 0.04
R5616:Cct6b UTSW 11 82741349 missense probably damaging 1.00
R5644:Cct6b UTSW 11 82722455 missense probably benign 0.02
R6862:Cct6b UTSW 11 82719959 missense probably damaging 1.00
X0060:Cct6b UTSW 11 82741310 missense probably benign 0.00
Z1176:Cct6b UTSW 11 82723939 missense probably damaging 1.00
Z1176:Cct6b UTSW 11 82764065 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACAAGCACTTGAGCTGTCC -3'
(R):5'- GCGTGCCAATTTTGTCTTCG -3'

Sequencing Primer
(F):5'- GCTGTCCGCTTCTCTCTCAC -3'
(R):5'- CTAGTCCAGGATGGTCTCAAACATG -3'
Posted On2016-10-24