Incidental Mutation 'R5560:Cep112'
ID436552
Institutional Source Beutler Lab
Gene Symbol Cep112
Ensembl Gene ENSMUSG00000020728
Gene Namecentrosomal protein 112
SynonymsMacoco, 8430407H02Rik, Ccdc46, 1700001M19Rik, 1700029K01Rik
MMRRC Submission 043117-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.511) question?
Stock #R5560 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location108425192-108860615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108437235 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 98 (K98Q)
Ref Sequence ENSEMBL: ENSMUSP00000122509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061287] [ENSMUST00000130515] [ENSMUST00000138538] [ENSMUST00000149683] [ENSMUST00000150863] [ENSMUST00000182729]
Predicted Effect probably damaging
Transcript: ENSMUST00000061287
AA Change: K46Q

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050597
Gene: ENSMUSG00000020728
AA Change: K46Q

DomainStartEndE-ValueType
Pfam:DUF4485 13 98 4.8e-31 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 954 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000130515
AA Change: K46Q

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114569
Gene: ENSMUSG00000020728
AA Change: K46Q

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 5.8e-31 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 954 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138538
AA Change: K46Q

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117192
Gene: ENSMUSG00000020728
AA Change: K46Q

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 6.7e-28 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143212
Predicted Effect probably damaging
Transcript: ENSMUST00000149683
AA Change: K46Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114452
Gene: ENSMUSG00000020728
AA Change: K46Q

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 5.2e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150863
AA Change: K98Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122509
Gene: ENSMUSG00000020728
AA Change: K98Q

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 6.8e-28 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 566 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182729
AA Change: K46Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138235
Gene: ENSMUSG00000020728
AA Change: K46Q

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 5.4e-31 PFAM
coiled coil region 233 299 N/A INTRINSIC
coiled coil region 355 435 N/A INTRINSIC
coiled coil region 462 912 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain containing protein that belongs to the cell division control protein 42 effector protein family. In neurons, it localizes to the cytoplasm of dendrites and is also enriched in the nucleus where it interacts with the RNA polymerase III transcriptional repressor Maf1 to regulate gamma-aminobutyric acid A receptor surface expression. In addition, the protein has been identified as a component of the human centrosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adipor1 T C 1: 134,426,040 W188R possibly damaging Het
Agrn T C 4: 156,178,497 D441G probably damaging Het
Ankrd55 T C 13: 112,383,490 S570P probably benign Het
Ano9 C G 7: 141,110,482 G80R probably damaging Het
Arhgef2 T A 3: 88,634,437 V250E probably damaging Het
Atp2b2 T C 6: 113,774,358 D583G possibly damaging Het
Bcar3 T A 3: 122,426,575 D40E possibly damaging Het
Capn12 A G 7: 28,882,860 D133G probably benign Het
Ccna1 A T 3: 55,048,569 Y269N probably damaging Het
Cct6b A T 11: 82,741,413 Y250N probably damaging Het
Chst13 T C 6: 90,318,269 D54G probably damaging Het
Clstn2 G T 9: 97,469,819 H518N possibly damaging Het
Cntnap1 T A 11: 101,182,435 L581M probably damaging Het
Cog3 T A 14: 75,729,393 M446L probably damaging Het
D430042O09Rik T C 7: 125,854,561 V1150A probably benign Het
Dennd2c T A 3: 103,161,555 I756K probably damaging Het
Dennd3 T G 15: 73,532,895 L273R probably damaging Het
Dhx34 C A 7: 16,218,541 R53L probably benign Het
Dnah9 G A 11: 65,881,740 T3722I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dusp6 A G 10: 99,266,241 Y217C probably damaging Het
Dyrk1b G A 7: 28,184,253 R178Q possibly damaging Het
Eif4g1 T A 16: 20,686,895 C1009S probably benign Het
Fam198a T C 9: 121,978,223 F478L possibly damaging Het
Frmpd1 A T 4: 45,243,697 T57S probably damaging Het
Gjc2 A G 11: 59,177,359 V99A possibly damaging Het
Gm9955 A T 18: 24,709,092 probably benign Het
Gpr158 A G 2: 21,826,290 I734V possibly damaging Het
Herc1 A T 9: 66,451,119 H2494L probably benign Het
Hist1h1c A G 13: 23,739,407 S187G probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmgcs1 A G 13: 119,699,815 probably null Het
Invs A T 4: 48,416,084 T655S probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Kcnj6 A T 16: 94,832,965 L96M probably benign Het
Lfng A G 5: 140,614,267 D354G possibly damaging Het
Lgsn T C 1: 31,196,872 L139P probably damaging Het
Madd C A 2: 91,163,545 V923L probably damaging Het
Mfsd7a A T 5: 108,448,863 M1K probably null Het
Mical1 A T 10: 41,478,965 I157F probably damaging Het
Mis18bp1 T C 12: 65,152,816 N154S possibly damaging Het
Mrps14 A G 1: 160,195,535 K6R probably benign Het
Mug1 T A 6: 121,861,073 C421S probably damaging Het
Myo18b A G 5: 112,868,295 I696T probably damaging Het
Naf1 T C 8: 66,883,545 Y375H probably damaging Het
Nsf T A 11: 103,863,255 E485V possibly damaging Het
Nup188 A G 2: 30,309,885 D307G probably damaging Het
Ocel1 C A 8: 71,372,478 P108T probably damaging Het
Oip5 A G 2: 119,613,059 S177P probably damaging Het
Olfr1436 G A 19: 12,298,644 Q163* probably null Het
Olfr365 A G 2: 37,201,930 I230V probably benign Het
Olfr51 A C 11: 51,007,523 I184L possibly damaging Het
Olfr943 A C 9: 39,184,184 E2A probably benign Het
Omg A G 11: 79,501,758 W425R possibly damaging Het
Pikfyve A G 1: 65,253,407 Y1339C probably damaging Het
Polr3e A G 7: 120,922,949 D6G possibly damaging Het
Pou4f3 C A 18: 42,395,415 P141Q probably benign Het
Rcsd1 T A 1: 165,655,501 N337I possibly damaging Het
Rhoj C T 12: 75,391,712 P91S probably damaging Het
Rnf10 A G 5: 115,249,998 F367S probably damaging Het
Rnft1 A T 11: 86,493,196 R307S probably benign Het
Ryr3 A T 2: 112,754,877 F2788Y probably damaging Het
Scgb1c1 A G 7: 140,846,224 K78E possibly damaging Het
Scn5a G T 9: 119,560,286 A123E probably damaging Het
Setd2 T A 9: 110,549,839 Y623* probably null Het
Tbl2 C T 5: 135,157,591 Q216* probably null Het
Thegl A G 5: 77,016,486 D112G possibly damaging Het
Tnc A G 4: 64,008,709 I860T probably damaging Het
Trafd1 T C 5: 121,373,303 K484R possibly damaging Het
Trank1 T C 9: 111,390,567 V2124A probably damaging Het
Trpm4 A T 7: 45,310,332 W713R probably damaging Het
Uap1l1 T C 2: 25,362,676 T451A probably benign Het
Uba6 A T 5: 86,131,260 C668S probably damaging Het
Ubxn11 T C 4: 134,126,624 F441S probably damaging Het
Vmn1r22 C T 6: 57,900,738 V85M probably damaging Het
Vmn2r72 T A 7: 85,751,942 I90L probably damaging Het
Wdr60 T C 12: 116,218,113 S769G probably damaging Het
Zfp330 T C 8: 82,764,956 E196G probably benign Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp994 T C 17: 22,201,713 E85G possibly damaging Het
Other mutations in Cep112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Cep112 APN 11 108591053 missense probably damaging 1.00
IGL00705:Cep112 APN 11 108472033 missense probably benign
IGL00848:Cep112 APN 11 108472060 missense probably damaging 1.00
IGL00975:Cep112 APN 11 108434186 missense probably damaging 1.00
IGL01085:Cep112 APN 11 108486606 missense probably damaging 1.00
IGL01286:Cep112 APN 11 108859409 critical splice donor site probably null
IGL01536:Cep112 APN 11 108531411 missense probably null 0.08
IGL02622:Cep112 APN 11 108518683 missense probably benign 0.26
IGL02720:Cep112 APN 11 108859351 missense probably damaging 0.98
FR4976:Cep112 UTSW 11 108425352 unclassified probably benign
PIT4466001:Cep112 UTSW 11 108519896 missense probably benign
R0727:Cep112 UTSW 11 108506554 missense probably damaging 1.00
R0907:Cep112 UTSW 11 108570432 splice site probably benign
R0908:Cep112 UTSW 11 108664497 missense possibly damaging 0.69
R1236:Cep112 UTSW 11 108859374 missense probably damaging 1.00
R1514:Cep112 UTSW 11 108472054 missense probably damaging 1.00
R2049:Cep112 UTSW 11 108606325 missense probably damaging 0.96
R2058:Cep112 UTSW 11 108519261 critical splice donor site probably null
R2059:Cep112 UTSW 11 108519261 critical splice donor site probably null
R2126:Cep112 UTSW 11 108508258 missense probably damaging 0.98
R2142:Cep112 UTSW 11 108606325 missense probably damaging 0.96
R2196:Cep112 UTSW 11 108570361 missense probably damaging 0.98
R2276:Cep112 UTSW 11 108855845 missense probably damaging 1.00
R2414:Cep112 UTSW 11 108752582 missense possibly damaging 0.91
R2655:Cep112 UTSW 11 108437201 splice site probably benign
R2882:Cep112 UTSW 11 108519212 missense possibly damaging 0.94
R3001:Cep112 UTSW 11 108440503 missense probably damaging 1.00
R3002:Cep112 UTSW 11 108440503 missense probably damaging 1.00
R3003:Cep112 UTSW 11 108440503 missense probably damaging 1.00
R4407:Cep112 UTSW 11 108519201 missense possibly damaging 0.93
R4796:Cep112 UTSW 11 108486992 critical splice donor site probably null
R4898:Cep112 UTSW 11 108506645 missense probably damaging 0.96
R4899:Cep112 UTSW 11 108606284 missense probably damaging 0.96
R4977:Cep112 UTSW 11 108434236 missense probably damaging 0.97
R5021:Cep112 UTSW 11 108470328 missense possibly damaging 0.86
R5186:Cep112 UTSW 11 108752560 missense probably benign 0.00
R5462:Cep112 UTSW 11 108518744 missense probably damaging 1.00
R5494:Cep112 UTSW 11 108664605 missense probably damaging 1.00
R5506:Cep112 UTSW 11 108664603 missense probably damaging 1.00
R5682:Cep112 UTSW 11 108470312 missense probably damaging 1.00
R5857:Cep112 UTSW 11 108531471 splice site probably benign
R5863:Cep112 UTSW 11 108606232 missense probably damaging 1.00
R5884:Cep112 UTSW 11 108570316 missense probably damaging 0.99
R5913:Cep112 UTSW 11 108757688 missense probably damaging 0.99
R6344:Cep112 UTSW 11 108519174 missense probably damaging 0.98
R6498:Cep112 UTSW 11 108440531 missense probably benign 0.25
R6611:Cep112 UTSW 11 108506551 missense possibly damaging 0.71
R6638:Cep112 UTSW 11 108855870 missense probably damaging 1.00
R6916:Cep112 UTSW 11 108859376 missense probably damaging 1.00
R7182:Cep112 UTSW 11 108682844 missense probably benign 0.07
R7262:Cep112 UTSW 11 108664641 missense probably damaging 0.99
R7386:Cep112 UTSW 11 108808681 missense probably benign 0.00
R7539:Cep112 UTSW 11 108855828 missense probably benign 0.38
Z1176:Cep112 UTSW 11 108425310 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGGCTGGCGCTATACAG -3'
(R):5'- TGCAGCTGTTGGTACCTACC -3'

Sequencing Primer
(F):5'- TTACATGGCCTAGAAAGCTTGAAGC -3'
(R):5'- CCATGTACGATGGCAATGTTTTCAG -3'
Posted On2016-10-24