Incidental Mutation 'R5560:Mis18bp1'
ID 436553
Institutional Source Beutler Lab
Gene Symbol Mis18bp1
Ensembl Gene ENSMUSG00000047534
Gene Name MIS18 binding protein 1
Synonyms C79407
MMRRC Submission 043117-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5560 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 65179508-65219363 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65199590 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 154 (N154S)
Ref Sequence ENSEMBL: ENSMUSP00000152132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052201] [ENSMUST00000124201] [ENSMUST00000221296] [ENSMUST00000222244]
AlphaFold Q80WQ8
Predicted Effect probably benign
Transcript: ENSMUST00000052201
AA Change: N437S

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000052109
Gene: ENSMUSG00000047534
AA Change: N437S

DomainStartEndE-ValueType
low complexity region 319 332 N/A INTRINSIC
Pfam:SANTA 336 425 1.4e-27 PFAM
coiled coil region 428 448 N/A INTRINSIC
coiled coil region 645 668 N/A INTRINSIC
SANT 742 794 9.48e-6 SMART
low complexity region 874 884 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149986
Predicted Effect possibly damaging
Transcript: ENSMUST00000221296
AA Change: N154S

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000222244
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adipor1 T C 1: 134,353,778 (GRCm39) W188R possibly damaging Het
Agrn T C 4: 156,262,954 (GRCm39) D441G probably damaging Het
Ankrd55 T C 13: 112,520,024 (GRCm39) S570P probably benign Het
Ano9 C G 7: 140,690,395 (GRCm39) G80R probably damaging Het
Arhgef2 T A 3: 88,541,744 (GRCm39) V250E probably damaging Het
Atp2b2 T C 6: 113,751,319 (GRCm39) D583G possibly damaging Het
Bcar3 T A 3: 122,220,224 (GRCm39) D40E possibly damaging Het
Capn12 A G 7: 28,582,285 (GRCm39) D133G probably benign Het
Ccna1 A T 3: 54,955,990 (GRCm39) Y269N probably damaging Het
Cct6b A T 11: 82,632,239 (GRCm39) Y250N probably damaging Het
Cep112 A C 11: 108,328,061 (GRCm39) K98Q probably damaging Het
Chst13 T C 6: 90,295,251 (GRCm39) D54G probably damaging Het
Clstn2 G T 9: 97,351,872 (GRCm39) H518N possibly damaging Het
Cntnap1 T A 11: 101,073,261 (GRCm39) L581M probably damaging Het
Cog3 T A 14: 75,966,833 (GRCm39) M446L probably damaging Het
Dennd2c T A 3: 103,068,871 (GRCm39) I756K probably damaging Het
Dennd3 T G 15: 73,404,744 (GRCm39) L273R probably damaging Het
Dhx34 C A 7: 15,952,466 (GRCm39) R53L probably benign Het
Dnah9 G A 11: 65,772,566 (GRCm39) T3722I probably benign Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Dusp6 A G 10: 99,102,103 (GRCm39) Y217C probably damaging Het
Dync2i1 T C 12: 116,181,733 (GRCm39) S769G probably damaging Het
Dyrk1b G A 7: 27,883,678 (GRCm39) R178Q possibly damaging Het
Eif4g1 T A 16: 20,505,645 (GRCm39) C1009S probably benign Het
Frmpd1 A T 4: 45,243,697 (GRCm39) T57S probably damaging Het
Gask1a T C 9: 121,807,289 (GRCm39) F478L possibly damaging Het
Gjc2 A G 11: 59,068,185 (GRCm39) V99A possibly damaging Het
Gm9955 A T 18: 24,842,149 (GRCm39) probably benign Het
Gpr158 A G 2: 21,831,101 (GRCm39) I734V possibly damaging Het
H1f2 A G 13: 23,923,390 (GRCm39) S187G probably benign Het
Herc1 A T 9: 66,358,401 (GRCm39) H2494L probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmgcs1 A G 13: 120,161,351 (GRCm39) probably null Het
Invs A T 4: 48,416,084 (GRCm39) T655S probably benign Het
Ipo9 G A 1: 135,329,983 (GRCm39) L486F probably damaging Het
Katnip T C 7: 125,453,733 (GRCm39) V1150A probably benign Het
Kcnj6 A T 16: 94,633,824 (GRCm39) L96M probably benign Het
Lfng A G 5: 140,600,022 (GRCm39) D354G possibly damaging Het
Lgsn T C 1: 31,235,953 (GRCm39) L139P probably damaging Het
Madd C A 2: 90,993,890 (GRCm39) V923L probably damaging Het
Mical1 A T 10: 41,354,961 (GRCm39) I157F probably damaging Het
Mrps14 A G 1: 160,023,105 (GRCm39) K6R probably benign Het
Mug1 T A 6: 121,838,032 (GRCm39) C421S probably damaging Het
Myo18b A G 5: 113,016,161 (GRCm39) I696T probably damaging Het
Naf1 T C 8: 67,336,197 (GRCm39) Y375H probably damaging Het
Nsf T A 11: 103,754,081 (GRCm39) E485V possibly damaging Het
Nup188 A G 2: 30,199,897 (GRCm39) D307G probably damaging Het
Ocel1 C A 8: 71,825,122 (GRCm39) P108T probably damaging Het
Oip5 A G 2: 119,443,540 (GRCm39) S177P probably damaging Het
Omg A G 11: 79,392,584 (GRCm39) W425R possibly damaging Het
Or1ad8 A C 11: 50,898,350 (GRCm39) I184L possibly damaging Het
Or1l4 A G 2: 37,091,942 (GRCm39) I230V probably benign Het
Or5an10 G A 19: 12,276,008 (GRCm39) Q163* probably null Het
Or8g26 A C 9: 39,095,480 (GRCm39) E2A probably benign Het
Pikfyve A G 1: 65,292,566 (GRCm39) Y1339C probably damaging Het
Polr3e A G 7: 120,522,172 (GRCm39) D6G possibly damaging Het
Pou4f3 C A 18: 42,528,480 (GRCm39) P141Q probably benign Het
Rcsd1 T A 1: 165,483,070 (GRCm39) N337I possibly damaging Het
Rhoj C T 12: 75,438,486 (GRCm39) P91S probably damaging Het
Rnf10 A G 5: 115,388,057 (GRCm39) F367S probably damaging Het
Rnft1 A T 11: 86,384,022 (GRCm39) R307S probably benign Het
Ryr3 A T 2: 112,585,222 (GRCm39) F2788Y probably damaging Het
Scgb1c1 A G 7: 140,426,137 (GRCm39) K78E possibly damaging Het
Scn5a G T 9: 119,389,352 (GRCm39) A123E probably damaging Het
Setd2 T A 9: 110,378,907 (GRCm39) Y623* probably null Het
Slc49a3 A T 5: 108,596,729 (GRCm39) M1K probably null Het
Spmap2l A G 5: 77,164,333 (GRCm39) D112G possibly damaging Het
Tbl2 C T 5: 135,186,445 (GRCm39) Q216* probably null Het
Tnc A G 4: 63,926,946 (GRCm39) I860T probably damaging Het
Trafd1 T C 5: 121,511,366 (GRCm39) K484R possibly damaging Het
Trank1 T C 9: 111,219,635 (GRCm39) V2124A probably damaging Het
Trpm4 A T 7: 44,959,756 (GRCm39) W713R probably damaging Het
Uap1l1 T C 2: 25,252,688 (GRCm39) T451A probably benign Het
Uba6 A T 5: 86,279,119 (GRCm39) C668S probably damaging Het
Ubxn11 T C 4: 133,853,935 (GRCm39) F441S probably damaging Het
Vmn1r22 C T 6: 57,877,723 (GRCm39) V85M probably damaging Het
Vmn2r72 T A 7: 85,401,150 (GRCm39) I90L probably damaging Het
Zfp330 T C 8: 83,491,585 (GRCm39) E196G probably benign Het
Zfp746 A G 6: 48,059,108 (GRCm39) V167A possibly damaging Het
Zfp994 T C 17: 22,420,694 (GRCm39) E85G possibly damaging Het
Other mutations in Mis18bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Mis18bp1 APN 12 65,205,215 (GRCm39) missense possibly damaging 0.68
IGL01383:Mis18bp1 APN 12 65,195,763 (GRCm39) missense probably benign 0.05
IGL01736:Mis18bp1 APN 12 65,185,452 (GRCm39) missense probably damaging 1.00
IGL02037:Mis18bp1 APN 12 65,183,522 (GRCm39) critical splice donor site probably null
IGL02210:Mis18bp1 APN 12 65,183,605 (GRCm39) nonsense probably null
IGL02318:Mis18bp1 APN 12 65,205,515 (GRCm39) missense probably benign 0.04
IGL02541:Mis18bp1 APN 12 65,208,234 (GRCm39) missense probably damaging 0.97
IGL02664:Mis18bp1 APN 12 65,200,654 (GRCm39) nonsense probably null
IGL02838:Mis18bp1 APN 12 65,183,600 (GRCm39) missense probably damaging 0.99
IGL03031:Mis18bp1 APN 12 65,208,704 (GRCm39) missense probably benign
PIT4453001:Mis18bp1 UTSW 12 65,205,447 (GRCm39) missense probably damaging 0.98
R0555:Mis18bp1 UTSW 12 65,208,227 (GRCm39) missense possibly damaging 0.94
R1169:Mis18bp1 UTSW 12 65,190,057 (GRCm39) nonsense probably null
R1517:Mis18bp1 UTSW 12 65,180,587 (GRCm39) missense probably benign 0.03
R1702:Mis18bp1 UTSW 12 65,208,518 (GRCm39) missense probably benign
R1705:Mis18bp1 UTSW 12 65,196,113 (GRCm39) missense probably benign 0.19
R1888:Mis18bp1 UTSW 12 65,196,102 (GRCm39) missense probably benign 0.01
R1888:Mis18bp1 UTSW 12 65,196,102 (GRCm39) missense probably benign 0.01
R1973:Mis18bp1 UTSW 12 65,195,850 (GRCm39) nonsense probably null
R1990:Mis18bp1 UTSW 12 65,205,468 (GRCm39) missense probably benign 0.03
R2023:Mis18bp1 UTSW 12 65,195,883 (GRCm39) missense probably damaging 0.97
R2043:Mis18bp1 UTSW 12 65,196,192 (GRCm39) missense probably damaging 1.00
R2318:Mis18bp1 UTSW 12 65,187,617 (GRCm39) missense possibly damaging 0.92
R2897:Mis18bp1 UTSW 12 65,180,360 (GRCm39) missense probably benign 0.09
R3120:Mis18bp1 UTSW 12 65,203,762 (GRCm39) splice site probably null
R3845:Mis18bp1 UTSW 12 65,195,916 (GRCm39) missense possibly damaging 0.61
R4578:Mis18bp1 UTSW 12 65,200,655 (GRCm39) missense probably damaging 1.00
R4590:Mis18bp1 UTSW 12 65,205,280 (GRCm39) missense possibly damaging 0.50
R4614:Mis18bp1 UTSW 12 65,200,303 (GRCm39) intron probably benign
R4626:Mis18bp1 UTSW 12 65,187,540 (GRCm39) missense probably damaging 1.00
R4724:Mis18bp1 UTSW 12 65,205,513 (GRCm39) missense probably benign 0.18
R4873:Mis18bp1 UTSW 12 65,208,209 (GRCm39) missense probably benign 0.23
R4875:Mis18bp1 UTSW 12 65,208,209 (GRCm39) missense probably benign 0.23
R5173:Mis18bp1 UTSW 12 65,196,149 (GRCm39) missense possibly damaging 0.96
R5294:Mis18bp1 UTSW 12 65,203,817 (GRCm39) missense probably damaging 1.00
R5540:Mis18bp1 UTSW 12 65,195,520 (GRCm39) missense possibly damaging 0.83
R5584:Mis18bp1 UTSW 12 65,201,550 (GRCm39) missense probably damaging 0.98
R5661:Mis18bp1 UTSW 12 65,195,626 (GRCm39) missense probably benign 0.41
R6235:Mis18bp1 UTSW 12 65,205,182 (GRCm39) missense probably damaging 0.99
R6282:Mis18bp1 UTSW 12 65,195,937 (GRCm39) missense probably benign 0.01
R6284:Mis18bp1 UTSW 12 65,185,561 (GRCm39) missense probably benign 0.32
R6378:Mis18bp1 UTSW 12 65,196,021 (GRCm39) missense probably benign 0.11
R6418:Mis18bp1 UTSW 12 65,205,317 (GRCm39) missense possibly damaging 0.64
R7103:Mis18bp1 UTSW 12 65,196,057 (GRCm39) missense possibly damaging 0.61
R7244:Mis18bp1 UTSW 12 65,208,404 (GRCm39) missense probably damaging 0.96
R7371:Mis18bp1 UTSW 12 65,205,368 (GRCm39) missense probably benign 0.18
R7623:Mis18bp1 UTSW 12 65,195,626 (GRCm39) missense probably benign 0.05
R7845:Mis18bp1 UTSW 12 65,196,102 (GRCm39) missense probably benign 0.01
R7898:Mis18bp1 UTSW 12 65,196,246 (GRCm39) missense probably benign 0.41
R7912:Mis18bp1 UTSW 12 65,199,532 (GRCm39) missense possibly damaging 0.92
R8057:Mis18bp1 UTSW 12 65,195,673 (GRCm39) missense possibly damaging 0.56
R8403:Mis18bp1 UTSW 12 65,201,585 (GRCm39) missense possibly damaging 0.87
R8834:Mis18bp1 UTSW 12 65,208,419 (GRCm39) missense probably benign 0.00
R8905:Mis18bp1 UTSW 12 65,180,401 (GRCm39) critical splice acceptor site probably null
R8996:Mis18bp1 UTSW 12 65,180,632 (GRCm39) missense probably benign 0.24
R9007:Mis18bp1 UTSW 12 65,180,616 (GRCm39) missense probably benign 0.28
R9257:Mis18bp1 UTSW 12 65,180,631 (GRCm39) missense probably benign 0.14
R9299:Mis18bp1 UTSW 12 65,185,538 (GRCm39) missense possibly damaging 0.94
R9534:Mis18bp1 UTSW 12 65,205,234 (GRCm39) missense possibly damaging 0.68
R9593:Mis18bp1 UTSW 12 65,187,628 (GRCm39) missense probably damaging 1.00
R9716:Mis18bp1 UTSW 12 65,205,337 (GRCm39) start gained probably benign
X0058:Mis18bp1 UTSW 12 65,196,000 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTCCTAATCAGTCAAAGAGCAC -3'
(R):5'- TCCTGGCCTCACATTTACTAGG -3'

Sequencing Primer
(F):5'- TCCTAATCAGTCAAAGAGCACCACAC -3'
(R):5'- GGGTCTCATGTAACAGGTTAACCTC -3'
Posted On 2016-10-24