Incidental Mutation 'R5560:Cog3'
ID436559
Institutional Source Beutler Lab
Gene Symbol Cog3
Ensembl Gene ENSMUSG00000034893
Gene Namecomponent of oligomeric golgi complex 3
Synonyms
MMRRC Submission 043117-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5560 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location75702350-75754517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75729393 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 446 (M446L)
Ref Sequence ENSEMBL: ENSMUSP00000154131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049168] [ENSMUST00000227473]
Predicted Effect probably damaging
Transcript: ENSMUST00000049168
AA Change: M456L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045016
Gene: ENSMUSG00000034893
AA Change: M456L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Sec34 130 277 9.5e-57 PFAM
Blast:HisKA 745 810 1e-5 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226686
Predicted Effect probably damaging
Transcript: ENSMUST00000227473
AA Change: M446L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228081
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the conserved oligomeric Golgi (COG) complex which is composed of eight different subunits and is required for normal Golgi morphology and localization. Defects in the COG complex result in multiple deficiencies in protein glycosylation. The protein encoded by this gene is involved in ER-Golgi transport.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adipor1 T C 1: 134,426,040 W188R possibly damaging Het
Agrn T C 4: 156,178,497 D441G probably damaging Het
Ankrd55 T C 13: 112,383,490 S570P probably benign Het
Ano9 C G 7: 141,110,482 G80R probably damaging Het
Arhgef2 T A 3: 88,634,437 V250E probably damaging Het
Atp2b2 T C 6: 113,774,358 D583G possibly damaging Het
Bcar3 T A 3: 122,426,575 D40E possibly damaging Het
Capn12 A G 7: 28,882,860 D133G probably benign Het
Ccna1 A T 3: 55,048,569 Y269N probably damaging Het
Cct6b A T 11: 82,741,413 Y250N probably damaging Het
Cep112 A C 11: 108,437,235 K98Q probably damaging Het
Chst13 T C 6: 90,318,269 D54G probably damaging Het
Clstn2 G T 9: 97,469,819 H518N possibly damaging Het
Cntnap1 T A 11: 101,182,435 L581M probably damaging Het
D430042O09Rik T C 7: 125,854,561 V1150A probably benign Het
Dennd2c T A 3: 103,161,555 I756K probably damaging Het
Dennd3 T G 15: 73,532,895 L273R probably damaging Het
Dhx34 C A 7: 16,218,541 R53L probably benign Het
Dnah9 G A 11: 65,881,740 T3722I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dusp6 A G 10: 99,266,241 Y217C probably damaging Het
Dyrk1b G A 7: 28,184,253 R178Q possibly damaging Het
Eif4g1 T A 16: 20,686,895 C1009S probably benign Het
Fam198a T C 9: 121,978,223 F478L possibly damaging Het
Frmpd1 A T 4: 45,243,697 T57S probably damaging Het
Gjc2 A G 11: 59,177,359 V99A possibly damaging Het
Gm9955 A T 18: 24,709,092 probably benign Het
Gpr158 A G 2: 21,826,290 I734V possibly damaging Het
Herc1 A T 9: 66,451,119 H2494L probably benign Het
Hist1h1c A G 13: 23,739,407 S187G probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmgcs1 A G 13: 119,699,815 probably null Het
Invs A T 4: 48,416,084 T655S probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Kcnj6 A T 16: 94,832,965 L96M probably benign Het
Lfng A G 5: 140,614,267 D354G possibly damaging Het
Lgsn T C 1: 31,196,872 L139P probably damaging Het
Madd C A 2: 91,163,545 V923L probably damaging Het
Mfsd7a A T 5: 108,448,863 M1K probably null Het
Mical1 A T 10: 41,478,965 I157F probably damaging Het
Mis18bp1 T C 12: 65,152,816 N154S possibly damaging Het
Mrps14 A G 1: 160,195,535 K6R probably benign Het
Mug1 T A 6: 121,861,073 C421S probably damaging Het
Myo18b A G 5: 112,868,295 I696T probably damaging Het
Naf1 T C 8: 66,883,545 Y375H probably damaging Het
Nsf T A 11: 103,863,255 E485V possibly damaging Het
Nup188 A G 2: 30,309,885 D307G probably damaging Het
Ocel1 C A 8: 71,372,478 P108T probably damaging Het
Oip5 A G 2: 119,613,059 S177P probably damaging Het
Olfr1436 G A 19: 12,298,644 Q163* probably null Het
Olfr365 A G 2: 37,201,930 I230V probably benign Het
Olfr51 A C 11: 51,007,523 I184L possibly damaging Het
Olfr943 A C 9: 39,184,184 E2A probably benign Het
Omg A G 11: 79,501,758 W425R possibly damaging Het
Pikfyve A G 1: 65,253,407 Y1339C probably damaging Het
Polr3e A G 7: 120,922,949 D6G possibly damaging Het
Pou4f3 C A 18: 42,395,415 P141Q probably benign Het
Rcsd1 T A 1: 165,655,501 N337I possibly damaging Het
Rhoj C T 12: 75,391,712 P91S probably damaging Het
Rnf10 A G 5: 115,249,998 F367S probably damaging Het
Rnft1 A T 11: 86,493,196 R307S probably benign Het
Ryr3 A T 2: 112,754,877 F2788Y probably damaging Het
Scgb1c1 A G 7: 140,846,224 K78E possibly damaging Het
Scn5a G T 9: 119,560,286 A123E probably damaging Het
Setd2 T A 9: 110,549,839 Y623* probably null Het
Tbl2 C T 5: 135,157,591 Q216* probably null Het
Thegl A G 5: 77,016,486 D112G possibly damaging Het
Tnc A G 4: 64,008,709 I860T probably damaging Het
Trafd1 T C 5: 121,373,303 K484R possibly damaging Het
Trank1 T C 9: 111,390,567 V2124A probably damaging Het
Trpm4 A T 7: 45,310,332 W713R probably damaging Het
Uap1l1 T C 2: 25,362,676 T451A probably benign Het
Uba6 A T 5: 86,131,260 C668S probably damaging Het
Ubxn11 T C 4: 134,126,624 F441S probably damaging Het
Vmn1r22 C T 6: 57,900,738 V85M probably damaging Het
Vmn2r72 T A 7: 85,751,942 I90L probably damaging Het
Wdr60 T C 12: 116,218,113 S769G probably damaging Het
Zfp330 T C 8: 82,764,956 E196G probably benign Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp994 T C 17: 22,201,713 E85G possibly damaging Het
Other mutations in Cog3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Cog3 APN 14 75730604 missense possibly damaging 0.79
IGL02637:Cog3 APN 14 75722196 splice site probably benign
IGL02934:Cog3 APN 14 75741689 missense probably damaging 0.99
R0105:Cog3 UTSW 14 75722140 missense probably damaging 0.99
R0105:Cog3 UTSW 14 75722140 missense probably damaging 0.99
R0403:Cog3 UTSW 14 75742327 splice site probably benign
R0972:Cog3 UTSW 14 75717170 missense probably benign
R1735:Cog3 UTSW 14 75729321 nonsense probably null
R1813:Cog3 UTSW 14 75742344 missense probably benign 0.03
R1896:Cog3 UTSW 14 75742344 missense probably benign 0.03
R2517:Cog3 UTSW 14 75741742 missense probably benign 0.01
R2567:Cog3 UTSW 14 75754290 missense probably benign
R2962:Cog3 UTSW 14 75740534 critical splice donor site probably null
R3103:Cog3 UTSW 14 75747201 critical splice acceptor site probably null
R3689:Cog3 UTSW 14 75754438 start codon destroyed probably null
R3691:Cog3 UTSW 14 75754438 start codon destroyed probably null
R3927:Cog3 UTSW 14 75743558 splice site probably benign
R4581:Cog3 UTSW 14 75732951 missense probably benign 0.04
R4932:Cog3 UTSW 14 75732954 missense probably damaging 0.98
R5654:Cog3 UTSW 14 75724799 missense probably benign 0.03
R6253:Cog3 UTSW 14 75719712 missense probably damaging 1.00
R6419:Cog3 UTSW 14 75724738 nonsense probably null
R6791:Cog3 UTSW 14 75730678 missense probably damaging 1.00
R6803:Cog3 UTSW 14 75704039 missense probably benign 0.00
R7015:Cog3 UTSW 14 75713276 missense possibly damaging 0.81
R7998:Cog3 UTSW 14 75747093 missense possibly damaging 0.94
R7999:Cog3 UTSW 14 75747093 missense possibly damaging 0.94
R8075:Cog3 UTSW 14 75730702 missense probably damaging 1.00
R8294:Cog3 UTSW 14 75717179 missense probably damaging 1.00
R8329:Cog3 UTSW 14 75740563 missense probably damaging 0.99
R8434:Cog3 UTSW 14 75742396 missense probably damaging 1.00
X0017:Cog3 UTSW 14 75741741 missense probably benign 0.01
X0021:Cog3 UTSW 14 75743593 missense possibly damaging 0.87
X0066:Cog3 UTSW 14 75741741 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTCACAAGCTGAGCAGGG -3'
(R):5'- GTTTTCAGAGTCCTGGGAAGAAGG -3'

Sequencing Primer
(F):5'- CTGAGCAGGGGCAGTGAGC -3'
(R):5'- TCTGAGGCAATTGAAAGCTAGTC -3'
Posted On2016-10-24