Incidental Mutation 'R5560:Cog3'
ID 436559
Institutional Source Beutler Lab
Gene Symbol Cog3
Ensembl Gene ENSMUSG00000034893
Gene Name component of oligomeric golgi complex 3
Synonyms
MMRRC Submission 043117-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5560 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 75939790-75991998 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75966833 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 446 (M446L)
Ref Sequence ENSEMBL: ENSMUSP00000154131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049168] [ENSMUST00000227473]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000049168
AA Change: M456L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045016
Gene: ENSMUSG00000034893
AA Change: M456L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Sec34 130 277 9.5e-57 PFAM
Blast:HisKA 745 810 1e-5 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226686
Predicted Effect probably damaging
Transcript: ENSMUST00000227473
AA Change: M446L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228081
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the conserved oligomeric Golgi (COG) complex which is composed of eight different subunits and is required for normal Golgi morphology and localization. Defects in the COG complex result in multiple deficiencies in protein glycosylation. The protein encoded by this gene is involved in ER-Golgi transport.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adipor1 T C 1: 134,353,778 (GRCm39) W188R possibly damaging Het
Agrn T C 4: 156,262,954 (GRCm39) D441G probably damaging Het
Ankrd55 T C 13: 112,520,024 (GRCm39) S570P probably benign Het
Ano9 C G 7: 140,690,395 (GRCm39) G80R probably damaging Het
Arhgef2 T A 3: 88,541,744 (GRCm39) V250E probably damaging Het
Atp2b2 T C 6: 113,751,319 (GRCm39) D583G possibly damaging Het
Bcar3 T A 3: 122,220,224 (GRCm39) D40E possibly damaging Het
Capn12 A G 7: 28,582,285 (GRCm39) D133G probably benign Het
Ccna1 A T 3: 54,955,990 (GRCm39) Y269N probably damaging Het
Cct6b A T 11: 82,632,239 (GRCm39) Y250N probably damaging Het
Cep112 A C 11: 108,328,061 (GRCm39) K98Q probably damaging Het
Chst13 T C 6: 90,295,251 (GRCm39) D54G probably damaging Het
Clstn2 G T 9: 97,351,872 (GRCm39) H518N possibly damaging Het
Cntnap1 T A 11: 101,073,261 (GRCm39) L581M probably damaging Het
Dennd2c T A 3: 103,068,871 (GRCm39) I756K probably damaging Het
Dennd3 T G 15: 73,404,744 (GRCm39) L273R probably damaging Het
Dhx34 C A 7: 15,952,466 (GRCm39) R53L probably benign Het
Dnah9 G A 11: 65,772,566 (GRCm39) T3722I probably benign Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Dusp6 A G 10: 99,102,103 (GRCm39) Y217C probably damaging Het
Dync2i1 T C 12: 116,181,733 (GRCm39) S769G probably damaging Het
Dyrk1b G A 7: 27,883,678 (GRCm39) R178Q possibly damaging Het
Eif4g1 T A 16: 20,505,645 (GRCm39) C1009S probably benign Het
Frmpd1 A T 4: 45,243,697 (GRCm39) T57S probably damaging Het
Gask1a T C 9: 121,807,289 (GRCm39) F478L possibly damaging Het
Gjc2 A G 11: 59,068,185 (GRCm39) V99A possibly damaging Het
Gm9955 A T 18: 24,842,149 (GRCm39) probably benign Het
Gpr158 A G 2: 21,831,101 (GRCm39) I734V possibly damaging Het
H1f2 A G 13: 23,923,390 (GRCm39) S187G probably benign Het
Herc1 A T 9: 66,358,401 (GRCm39) H2494L probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hmgcs1 A G 13: 120,161,351 (GRCm39) probably null Het
Invs A T 4: 48,416,084 (GRCm39) T655S probably benign Het
Ipo9 G A 1: 135,329,983 (GRCm39) L486F probably damaging Het
Katnip T C 7: 125,453,733 (GRCm39) V1150A probably benign Het
Kcnj6 A T 16: 94,633,824 (GRCm39) L96M probably benign Het
Lfng A G 5: 140,600,022 (GRCm39) D354G possibly damaging Het
Lgsn T C 1: 31,235,953 (GRCm39) L139P probably damaging Het
Madd C A 2: 90,993,890 (GRCm39) V923L probably damaging Het
Mical1 A T 10: 41,354,961 (GRCm39) I157F probably damaging Het
Mis18bp1 T C 12: 65,199,590 (GRCm39) N154S possibly damaging Het
Mrps14 A G 1: 160,023,105 (GRCm39) K6R probably benign Het
Mug1 T A 6: 121,838,032 (GRCm39) C421S probably damaging Het
Myo18b A G 5: 113,016,161 (GRCm39) I696T probably damaging Het
Naf1 T C 8: 67,336,197 (GRCm39) Y375H probably damaging Het
Nsf T A 11: 103,754,081 (GRCm39) E485V possibly damaging Het
Nup188 A G 2: 30,199,897 (GRCm39) D307G probably damaging Het
Ocel1 C A 8: 71,825,122 (GRCm39) P108T probably damaging Het
Oip5 A G 2: 119,443,540 (GRCm39) S177P probably damaging Het
Omg A G 11: 79,392,584 (GRCm39) W425R possibly damaging Het
Or1ad8 A C 11: 50,898,350 (GRCm39) I184L possibly damaging Het
Or1l4 A G 2: 37,091,942 (GRCm39) I230V probably benign Het
Or5an10 G A 19: 12,276,008 (GRCm39) Q163* probably null Het
Or8g26 A C 9: 39,095,480 (GRCm39) E2A probably benign Het
Pikfyve A G 1: 65,292,566 (GRCm39) Y1339C probably damaging Het
Polr3e A G 7: 120,522,172 (GRCm39) D6G possibly damaging Het
Pou4f3 C A 18: 42,528,480 (GRCm39) P141Q probably benign Het
Rcsd1 T A 1: 165,483,070 (GRCm39) N337I possibly damaging Het
Rhoj C T 12: 75,438,486 (GRCm39) P91S probably damaging Het
Rnf10 A G 5: 115,388,057 (GRCm39) F367S probably damaging Het
Rnft1 A T 11: 86,384,022 (GRCm39) R307S probably benign Het
Ryr3 A T 2: 112,585,222 (GRCm39) F2788Y probably damaging Het
Scgb1c1 A G 7: 140,426,137 (GRCm39) K78E possibly damaging Het
Scn5a G T 9: 119,389,352 (GRCm39) A123E probably damaging Het
Setd2 T A 9: 110,378,907 (GRCm39) Y623* probably null Het
Slc49a3 A T 5: 108,596,729 (GRCm39) M1K probably null Het
Spmap2l A G 5: 77,164,333 (GRCm39) D112G possibly damaging Het
Tbl2 C T 5: 135,186,445 (GRCm39) Q216* probably null Het
Tnc A G 4: 63,926,946 (GRCm39) I860T probably damaging Het
Trafd1 T C 5: 121,511,366 (GRCm39) K484R possibly damaging Het
Trank1 T C 9: 111,219,635 (GRCm39) V2124A probably damaging Het
Trpm4 A T 7: 44,959,756 (GRCm39) W713R probably damaging Het
Uap1l1 T C 2: 25,252,688 (GRCm39) T451A probably benign Het
Uba6 A T 5: 86,279,119 (GRCm39) C668S probably damaging Het
Ubxn11 T C 4: 133,853,935 (GRCm39) F441S probably damaging Het
Vmn1r22 C T 6: 57,877,723 (GRCm39) V85M probably damaging Het
Vmn2r72 T A 7: 85,401,150 (GRCm39) I90L probably damaging Het
Zfp330 T C 8: 83,491,585 (GRCm39) E196G probably benign Het
Zfp746 A G 6: 48,059,108 (GRCm39) V167A possibly damaging Het
Zfp994 T C 17: 22,420,694 (GRCm39) E85G possibly damaging Het
Other mutations in Cog3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Cog3 APN 14 75,968,044 (GRCm39) missense possibly damaging 0.79
IGL02637:Cog3 APN 14 75,959,636 (GRCm39) splice site probably benign
IGL02934:Cog3 APN 14 75,979,129 (GRCm39) missense probably damaging 0.99
R0105:Cog3 UTSW 14 75,959,580 (GRCm39) missense probably damaging 0.99
R0105:Cog3 UTSW 14 75,959,580 (GRCm39) missense probably damaging 0.99
R0403:Cog3 UTSW 14 75,979,767 (GRCm39) splice site probably benign
R0972:Cog3 UTSW 14 75,954,610 (GRCm39) missense probably benign
R1735:Cog3 UTSW 14 75,966,761 (GRCm39) nonsense probably null
R1813:Cog3 UTSW 14 75,979,784 (GRCm39) missense probably benign 0.03
R1896:Cog3 UTSW 14 75,979,784 (GRCm39) missense probably benign 0.03
R2517:Cog3 UTSW 14 75,979,182 (GRCm39) missense probably benign 0.01
R2567:Cog3 UTSW 14 75,991,730 (GRCm39) missense probably benign
R2962:Cog3 UTSW 14 75,977,974 (GRCm39) critical splice donor site probably null
R3103:Cog3 UTSW 14 75,984,641 (GRCm39) critical splice acceptor site probably null
R3689:Cog3 UTSW 14 75,991,878 (GRCm39) start codon destroyed probably null
R3691:Cog3 UTSW 14 75,991,878 (GRCm39) start codon destroyed probably null
R3927:Cog3 UTSW 14 75,980,998 (GRCm39) splice site probably benign
R4581:Cog3 UTSW 14 75,970,391 (GRCm39) missense probably benign 0.04
R4932:Cog3 UTSW 14 75,970,394 (GRCm39) missense probably damaging 0.98
R5654:Cog3 UTSW 14 75,962,239 (GRCm39) missense probably benign 0.03
R6253:Cog3 UTSW 14 75,957,152 (GRCm39) missense probably damaging 1.00
R6419:Cog3 UTSW 14 75,962,178 (GRCm39) nonsense probably null
R6791:Cog3 UTSW 14 75,968,118 (GRCm39) missense probably damaging 1.00
R6803:Cog3 UTSW 14 75,941,479 (GRCm39) missense probably benign 0.00
R7015:Cog3 UTSW 14 75,950,716 (GRCm39) missense possibly damaging 0.81
R7998:Cog3 UTSW 14 75,984,533 (GRCm39) missense possibly damaging 0.94
R7999:Cog3 UTSW 14 75,984,533 (GRCm39) missense possibly damaging 0.94
R8075:Cog3 UTSW 14 75,968,142 (GRCm39) missense probably damaging 1.00
R8294:Cog3 UTSW 14 75,954,619 (GRCm39) missense probably damaging 1.00
R8329:Cog3 UTSW 14 75,978,003 (GRCm39) missense probably damaging 0.99
R8434:Cog3 UTSW 14 75,979,836 (GRCm39) missense probably damaging 1.00
R9170:Cog3 UTSW 14 75,966,802 (GRCm39) missense probably damaging 1.00
X0017:Cog3 UTSW 14 75,979,181 (GRCm39) missense probably benign 0.01
X0021:Cog3 UTSW 14 75,981,033 (GRCm39) missense possibly damaging 0.87
X0066:Cog3 UTSW 14 75,979,181 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATTCACAAGCTGAGCAGGG -3'
(R):5'- GTTTTCAGAGTCCTGGGAAGAAGG -3'

Sequencing Primer
(F):5'- CTGAGCAGGGGCAGTGAGC -3'
(R):5'- TCTGAGGCAATTGAAAGCTAGTC -3'
Posted On 2016-10-24