Incidental Mutation 'R0006:Erbb3'
ID 43656
Institutional Source Beutler Lab
Gene Symbol Erbb3
Ensembl Gene ENSMUSG00000018166
Gene Name erb-b2 receptor tyrosine kinase 3
Synonyms Erbb3r, Erbb-3, HER3
MMRRC Submission 041980-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0006 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 128403392-128425504 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 128409279 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082059]
AlphaFold Q61526
Predicted Effect probably null
Transcript: ENSMUST00000082059
SMART Domains Protein: ENSMUSP00000080716
Gene: ENSMUSG00000018166

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 2.4e-31 PFAM
FU 180 220 5.83e0 SMART
FU 223 265 7.63e-10 SMART
Pfam:Recep_L_domain 353 474 7.5e-33 PFAM
FU 490 541 7.82e-7 SMART
FU 546 595 1.34e-5 SMART
FU 607 643 9.24e0 SMART
TyrKc 707 963 7.42e-91 SMART
low complexity region 997 1018 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1135 1148 N/A INTRINSIC
low complexity region 1172 1185 N/A INTRINSIC
low complexity region 1186 1196 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
Meta Mutation Damage Score 0.9482 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound protein has a neuregulin binding domain but not an active kinase domain. It therefore can bind this ligand but not convey the signal into the cell through protein phosphorylation. However, it does form heterodimers with other EGF receptor family members which do have kinase activity. Heterodimerization leads to the activation of pathways which lead to cell proliferation or differentiation. Amplification of this gene and/or overexpression of its protein have been reported in numerous cancers, including prostate, bladder, and breast tumors. Alternate transcriptional splice variants encoding different isoforms have been characterized. One isoform lacks the intermembrane region and is secreted outside the cell. This form acts to modulate the activity of the membrane-bound form. Additional splice variants have also been reported, but they have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a lack of Schwann-cell precursors leading to loss of sensory and motor neurons, hypoplasia of the primary sympathetic ganglion chain, cardiac defects, impaired brain development, and embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(27) : Targeted(11) Gene trapped(14) Chemically induced(2)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,813,935 (GRCm39) probably benign Het
Aldh3a1 G A 11: 61,107,927 (GRCm39) V324M probably damaging Het
Als2cl T A 9: 110,723,686 (GRCm39) L694Q possibly damaging Het
Appl2 A G 10: 83,438,762 (GRCm39) F556L probably damaging Het
Atad2b T A 12: 4,992,030 (GRCm39) S210T possibly damaging Het
Aurka A G 2: 172,201,673 (GRCm39) probably null Het
Boc C T 16: 44,316,812 (GRCm39) V444I probably benign Het
Cfap61 G A 2: 145,919,232 (GRCm39) V655I probably benign Het
Chd8 A G 14: 52,472,750 (GRCm39) I351T possibly damaging Het
Chid1 T A 7: 141,076,339 (GRCm39) probably benign Het
Cyp3a41a T A 5: 145,641,606 (GRCm39) H288L probably benign Het
Dnase2b T A 3: 146,288,244 (GRCm39) I284F probably damaging Het
Dock2 A G 11: 34,262,453 (GRCm39) probably benign Het
Dst C T 1: 34,267,999 (GRCm39) T5325I probably benign Het
Fancl A G 11: 26,419,695 (GRCm39) N316S possibly damaging Het
Farsa G T 8: 85,587,934 (GRCm39) probably benign Het
Fibcd1 T G 2: 31,728,599 (GRCm39) D86A probably damaging Het
Gab1 A T 8: 81,496,359 (GRCm39) M617K possibly damaging Het
Gabrd C A 4: 155,473,058 (GRCm39) V72L probably damaging Het
Ggh C A 4: 20,054,155 (GRCm39) T150K possibly damaging Het
Gnb3 G A 6: 124,812,767 (GRCm39) probably benign Het
Hephl1 T A 9: 14,988,060 (GRCm39) T683S probably benign Het
Hmcn1 G A 1: 150,684,427 (GRCm39) P381L probably damaging Het
Hspa8 T G 9: 40,715,925 (GRCm39) N544K probably benign Het
Hspg2 C T 4: 137,247,242 (GRCm39) T1155I probably damaging Het
Igdcc4 C T 9: 65,042,382 (GRCm39) probably benign Het
Jazf1 A G 6: 52,871,071 (GRCm39) probably benign Het
Kntc1 T A 5: 123,927,201 (GRCm39) S1219T probably benign Het
L3mbtl1 A T 2: 162,806,489 (GRCm39) Y460F possibly damaging Het
Lcor A G 19: 41,573,338 (GRCm39) T698A probably benign Het
Lyrm7 T A 11: 54,739,423 (GRCm39) T76S probably benign Het
Map1b C T 13: 99,571,810 (GRCm39) V304M probably damaging Het
Mcub A C 3: 129,727,414 (GRCm39) probably benign Het
Muc13 T C 16: 33,623,518 (GRCm39) S271P probably damaging Het
Myo16 A G 8: 10,525,988 (GRCm39) K843E probably damaging Het
Nav2 A G 7: 49,102,978 (GRCm39) E531G possibly damaging Het
Niban3 A G 8: 72,057,688 (GRCm39) probably benign Het
Nup188 T C 2: 30,212,035 (GRCm39) V553A probably benign Het
Or1e16 A G 11: 73,286,314 (GRCm39) F178S probably damaging Het
Or1e1c A G 11: 73,266,414 (GRCm39) M283V possibly damaging Het
Or52d1 A G 7: 103,755,527 (GRCm39) I14V probably benign Het
Or6z1 A G 7: 6,504,610 (GRCm39) I205T possibly damaging Het
Or8b9 T A 9: 37,766,516 (GRCm39) V134D possibly damaging Het
P4ha3 C T 7: 99,968,155 (GRCm39) R378* probably null Het
Rap1gds1 G T 3: 138,689,632 (GRCm39) probably null Het
Rbfox1 T A 16: 7,148,284 (GRCm39) S244R probably benign Het
Rpp40 G A 13: 36,080,718 (GRCm39) P339S probably damaging Het
Rsph4a T C 10: 33,785,144 (GRCm39) C148R probably damaging Het
Skint5 T C 4: 113,751,059 (GRCm39) probably benign Het
Sptbn1 A G 11: 30,073,855 (GRCm39) S1405P probably damaging Het
Tex35 T C 1: 156,927,314 (GRCm39) K154E possibly damaging Het
Thada T C 17: 84,533,468 (GRCm39) N1661S probably benign Het
Tle4 A G 19: 14,444,078 (GRCm39) probably benign Het
Tnxb T C 17: 34,901,266 (GRCm39) S1027P probably benign Het
Tpm3 T A 3: 89,994,968 (GRCm39) probably benign Het
Ubr4 T C 4: 139,158,960 (GRCm39) F2438L probably benign Het
Uggt2 A T 14: 119,287,075 (GRCm39) F640L probably benign Het
Vmn1r20 T G 6: 57,409,290 (GRCm39) H205Q probably damaging Het
Wbp2 T C 11: 115,970,614 (GRCm39) probably null Het
Xirp1 T C 9: 119,846,520 (GRCm39) I788V probably benign Het
Zc3hav1 A G 6: 38,296,637 (GRCm39) probably null Het
Zfp687 A G 3: 94,918,767 (GRCm39) I335T probably damaging Het
Zfpm1 A G 8: 123,061,227 (GRCm39) Y264C probably damaging Het
Other mutations in Erbb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Erbb3 APN 10 128,406,852 (GRCm39) missense probably damaging 0.99
IGL01482:Erbb3 APN 10 128,408,798 (GRCm39) missense possibly damaging 0.87
IGL01866:Erbb3 APN 10 128,405,237 (GRCm39) makesense probably null
IGL01981:Erbb3 APN 10 128,407,519 (GRCm39) missense probably benign 0.28
IGL02190:Erbb3 APN 10 128,406,879 (GRCm39) splice site probably null
IGL02329:Erbb3 APN 10 128,409,088 (GRCm39) missense probably damaging 1.00
IGL02400:Erbb3 APN 10 128,415,393 (GRCm39) missense probably benign 0.02
IGL02478:Erbb3 APN 10 128,407,227 (GRCm39) nonsense probably null
IGL02502:Erbb3 APN 10 128,406,153 (GRCm39) missense probably benign
IGL02539:Erbb3 APN 10 128,420,174 (GRCm39) splice site probably null
IGL03187:Erbb3 APN 10 128,408,463 (GRCm39) splice site probably benign
I1329:Erbb3 UTSW 10 128,419,323 (GRCm39) missense possibly damaging 0.73
PIT4812001:Erbb3 UTSW 10 128,410,248 (GRCm39) missense possibly damaging 0.67
R0006:Erbb3 UTSW 10 128,409,279 (GRCm39) critical splice donor site probably null
R0078:Erbb3 UTSW 10 128,419,310 (GRCm39) missense probably damaging 1.00
R0366:Erbb3 UTSW 10 128,408,439 (GRCm39) missense possibly damaging 0.77
R0601:Erbb3 UTSW 10 128,412,881 (GRCm39) missense probably benign 0.01
R0621:Erbb3 UTSW 10 128,422,094 (GRCm39) missense probably benign 0.00
R1222:Erbb3 UTSW 10 128,407,534 (GRCm39) missense probably damaging 1.00
R1675:Erbb3 UTSW 10 128,407,073 (GRCm39) missense probably damaging 0.97
R1676:Erbb3 UTSW 10 128,419,117 (GRCm39) missense probably benign 0.08
R1692:Erbb3 UTSW 10 128,407,594 (GRCm39) missense probably benign 0.19
R1875:Erbb3 UTSW 10 128,410,335 (GRCm39) missense possibly damaging 0.71
R2002:Erbb3 UTSW 10 128,422,094 (GRCm39) missense probably benign 0.00
R2219:Erbb3 UTSW 10 128,405,740 (GRCm39) missense probably damaging 0.99
R2328:Erbb3 UTSW 10 128,419,562 (GRCm39) missense probably damaging 1.00
R3840:Erbb3 UTSW 10 128,406,193 (GRCm39) missense probably benign
R4393:Erbb3 UTSW 10 128,408,639 (GRCm39) missense probably damaging 1.00
R4567:Erbb3 UTSW 10 128,414,944 (GRCm39) missense probably damaging 1.00
R4616:Erbb3 UTSW 10 128,408,639 (GRCm39) nonsense probably null
R4766:Erbb3 UTSW 10 128,422,107 (GRCm39) missense possibly damaging 0.76
R4881:Erbb3 UTSW 10 128,412,816 (GRCm39) missense probably benign 0.00
R4974:Erbb3 UTSW 10 128,408,317 (GRCm39) missense probably benign
R5266:Erbb3 UTSW 10 128,405,505 (GRCm39) missense probably damaging 1.00
R5463:Erbb3 UTSW 10 128,405,948 (GRCm39) nonsense probably null
R5481:Erbb3 UTSW 10 128,408,349 (GRCm39) missense probably damaging 0.98
R5997:Erbb3 UTSW 10 128,419,054 (GRCm39) missense probably damaging 1.00
R6370:Erbb3 UTSW 10 128,405,943 (GRCm39) missense possibly damaging 0.90
R7639:Erbb3 UTSW 10 128,405,716 (GRCm39) missense probably damaging 0.99
R7713:Erbb3 UTSW 10 128,410,318 (GRCm39) missense probably benign
R7847:Erbb3 UTSW 10 128,407,058 (GRCm39) missense probably damaging 1.00
R8529:Erbb3 UTSW 10 128,419,069 (GRCm39) missense probably damaging 0.99
R8843:Erbb3 UTSW 10 128,414,325 (GRCm39) missense possibly damaging 0.82
R8988:Erbb3 UTSW 10 128,406,030 (GRCm39) missense probably damaging 1.00
R9336:Erbb3 UTSW 10 128,420,929 (GRCm39) missense probably benign 0.15
R9530:Erbb3 UTSW 10 128,410,291 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAAGATCATATGCCTACATGCCCG -3'
(R):5'- TGCTCTTGGTGCAGAGGCAATAG -3'

Sequencing Primer
(F):5'- GTCCTCGATGACTTTAATGCAGAC -3'
(R):5'- CAATAGGTGGGACTAGGCTTGTG -3'
Posted On 2013-05-29