Incidental Mutation 'R5560:Kcnj6'
ID436563
Institutional Source Beutler Lab
Gene Symbol Kcnj6
Ensembl Gene ENSMUSG00000043301
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 6
SynonymsKCNJ7, GIRK2, Kir3.2
MMRRC Submission 043117-MU
Accession Numbers

Genbank: NM_001025584.2, NM_001025585.2, NM_001025590.1, NM_010606.2  

Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R5560 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location94748636-94997701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94832965 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 96 (L96M)
Ref Sequence ENSEMBL: ENSMUSP00000093558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095873] [ENSMUST00000099508] [ENSMUST00000165538] [ENSMUST00000232562]
PDB Structure Crystal Structure of the Cytoplasmic Domain of G-Protein-Gated Inward Rectifier Potassium Channel Kir3.2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000095873
AA Change: L96M

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000093558
Gene: ENSMUSG00000043301
AA Change: L96M

DomainStartEndE-ValueType
Pfam:IRK 59 397 9.3e-166 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099508
AA Change: L96M

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000097108
Gene: ENSMUSG00000043301
AA Change: L96M

DomainStartEndE-ValueType
Pfam:IRK 59 382 8.5e-146 PFAM
low complexity region 396 411 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165538
AA Change: L78M

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000130321
Gene: ENSMUSG00000043301
AA Change: L78M

DomainStartEndE-ValueType
Pfam:IRK 41 302 5.3e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232403
Predicted Effect probably benign
Transcript: ENSMUST00000232562
AA Change: L78M

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled inwardly-rectifying potassium channel family of inward rectifier potassium channels. This type of potassium channel allows a greater flow of potassium into the cell than out of it. These proteins modulate many physiological processes, including heart rate in cardiac cells and circuit activity in neuronal cells, through G-protein coupled receptor stimulation. Mutations in this gene are associated with Keppen-Lubinsky Syndrome, a rare condition characterized by severe developmental delay, facial dysmorphism, and intellectual disability. [provided by RefSeq, Apr 2015]
PHENOTYPE: A spontaneous mutation exhibits small size, ataxia, hypotonia, high periweaning mortality, Purkinje cell defects, and male sterility. Homozygotes for a targeted null mutation exhibit increased susceptibility to spontaneous and drug-induced seizures. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(1) Spontaneous(1)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adipor1 T C 1: 134,426,040 W188R possibly damaging Het
Agrn T C 4: 156,178,497 D441G probably damaging Het
Ankrd55 T C 13: 112,383,490 S570P probably benign Het
Ano9 C G 7: 141,110,482 G80R probably damaging Het
Arhgef2 T A 3: 88,634,437 V250E probably damaging Het
Atp2b2 T C 6: 113,774,358 D583G possibly damaging Het
Bcar3 T A 3: 122,426,575 D40E possibly damaging Het
Capn12 A G 7: 28,882,860 D133G probably benign Het
Ccna1 A T 3: 55,048,569 Y269N probably damaging Het
Cct6b A T 11: 82,741,413 Y250N probably damaging Het
Cep112 A C 11: 108,437,235 K98Q probably damaging Het
Chst13 T C 6: 90,318,269 D54G probably damaging Het
Clstn2 G T 9: 97,469,819 H518N possibly damaging Het
Cntnap1 T A 11: 101,182,435 L581M probably damaging Het
Cog3 T A 14: 75,729,393 M446L probably damaging Het
D430042O09Rik T C 7: 125,854,561 V1150A probably benign Het
Dennd2c T A 3: 103,161,555 I756K probably damaging Het
Dennd3 T G 15: 73,532,895 L273R probably damaging Het
Dhx34 C A 7: 16,218,541 R53L probably benign Het
Dnah9 G A 11: 65,881,740 T3722I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dusp6 A G 10: 99,266,241 Y217C probably damaging Het
Dyrk1b G A 7: 28,184,253 R178Q possibly damaging Het
Eif4g1 T A 16: 20,686,895 C1009S probably benign Het
Fam198a T C 9: 121,978,223 F478L possibly damaging Het
Frmpd1 A T 4: 45,243,697 T57S probably damaging Het
Gjc2 A G 11: 59,177,359 V99A possibly damaging Het
Gm9955 A T 18: 24,709,092 probably benign Het
Gpr158 A G 2: 21,826,290 I734V possibly damaging Het
Herc1 A T 9: 66,451,119 H2494L probably benign Het
Hist1h1c A G 13: 23,739,407 S187G probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmgcs1 A G 13: 119,699,815 probably null Het
Invs A T 4: 48,416,084 T655S probably benign Het
Ipo9 G A 1: 135,402,245 L486F probably damaging Het
Lfng A G 5: 140,614,267 D354G possibly damaging Het
Lgsn T C 1: 31,196,872 L139P probably damaging Het
Madd C A 2: 91,163,545 V923L probably damaging Het
Mfsd7a A T 5: 108,448,863 M1K probably null Het
Mical1 A T 10: 41,478,965 I157F probably damaging Het
Mis18bp1 T C 12: 65,152,816 N154S possibly damaging Het
Mrps14 A G 1: 160,195,535 K6R probably benign Het
Mug1 T A 6: 121,861,073 C421S probably damaging Het
Myo18b A G 5: 112,868,295 I696T probably damaging Het
Naf1 T C 8: 66,883,545 Y375H probably damaging Het
Nsf T A 11: 103,863,255 E485V possibly damaging Het
Nup188 A G 2: 30,309,885 D307G probably damaging Het
Ocel1 C A 8: 71,372,478 P108T probably damaging Het
Oip5 A G 2: 119,613,059 S177P probably damaging Het
Olfr1436 G A 19: 12,298,644 Q163* probably null Het
Olfr365 A G 2: 37,201,930 I230V probably benign Het
Olfr51 A C 11: 51,007,523 I184L possibly damaging Het
Olfr943 A C 9: 39,184,184 E2A probably benign Het
Omg A G 11: 79,501,758 W425R possibly damaging Het
Pikfyve A G 1: 65,253,407 Y1339C probably damaging Het
Polr3e A G 7: 120,922,949 D6G possibly damaging Het
Pou4f3 C A 18: 42,395,415 P141Q probably benign Het
Rcsd1 T A 1: 165,655,501 N337I possibly damaging Het
Rhoj C T 12: 75,391,712 P91S probably damaging Het
Rnf10 A G 5: 115,249,998 F367S probably damaging Het
Rnft1 A T 11: 86,493,196 R307S probably benign Het
Ryr3 A T 2: 112,754,877 F2788Y probably damaging Het
Scgb1c1 A G 7: 140,846,224 K78E possibly damaging Het
Scn5a G T 9: 119,560,286 A123E probably damaging Het
Setd2 T A 9: 110,549,839 Y623* probably null Het
Tbl2 C T 5: 135,157,591 Q216* probably null Het
Thegl A G 5: 77,016,486 D112G possibly damaging Het
Tnc A G 4: 64,008,709 I860T probably damaging Het
Trafd1 T C 5: 121,373,303 K484R possibly damaging Het
Trank1 T C 9: 111,390,567 V2124A probably damaging Het
Trpm4 A T 7: 45,310,332 W713R probably damaging Het
Uap1l1 T C 2: 25,362,676 T451A probably benign Het
Uba6 A T 5: 86,131,260 C668S probably damaging Het
Ubxn11 T C 4: 134,126,624 F441S probably damaging Het
Vmn1r22 C T 6: 57,900,738 V85M probably damaging Het
Vmn2r72 T A 7: 85,751,942 I90L probably damaging Het
Wdr60 T C 12: 116,218,113 S769G probably damaging Het
Zfp330 T C 8: 82,764,956 E196G probably benign Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp994 T C 17: 22,201,713 E85G possibly damaging Het
Other mutations in Kcnj6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Kcnj6 APN 16 94832455 missense probably damaging 0.99
IGL01433:Kcnj6 APN 16 94832955 missense probably benign 0.21
IGL01603:Kcnj6 APN 16 94833199 missense probably benign 0.00
IGL02212:Kcnj6 APN 16 94832487 missense probably damaging 1.00
IGL02982:Kcnj6 APN 16 94832517 missense possibly damaging 0.89
IGL03351:Kcnj6 APN 16 94832583 missense probably damaging 1.00
Seizure UTSW 16 94832659 missense probably damaging 1.00
H8477:Kcnj6 UTSW 16 94832937 missense probably damaging 1.00
IGL02796:Kcnj6 UTSW 16 94832919 missense probably benign 0.00
R0070:Kcnj6 UTSW 16 94941197 missense probably benign
R1558:Kcnj6 UTSW 16 94762499 missense possibly damaging 0.57
R1676:Kcnj6 UTSW 16 94832584 missense probably damaging 1.00
R2435:Kcnj6 UTSW 16 94762679 missense probably damaging 0.99
R3700:Kcnj6 UTSW 16 94833006 missense probably damaging 0.96
R3800:Kcnj6 UTSW 16 94833027 missense probably damaging 1.00
R4012:Kcnj6 UTSW 16 94825018 splice site probably null
R4899:Kcnj6 UTSW 16 94832613 missense probably damaging 1.00
R5124:Kcnj6 UTSW 16 94832659 missense probably damaging 1.00
R5359:Kcnj6 UTSW 16 94832453 nonsense probably null
R5583:Kcnj6 UTSW 16 94833201 missense probably benign 0.26
R6057:Kcnj6 UTSW 16 94832377 missense probably damaging 1.00
R6330:Kcnj6 UTSW 16 94762601 missense possibly damaging 0.93
R6582:Kcnj6 UTSW 16 94832826 missense possibly damaging 0.93
R6604:Kcnj6 UTSW 16 94762645 missense probably damaging 1.00
R6802:Kcnj6 UTSW 16 94762577 missense probably benign 0.06
R6866:Kcnj6 UTSW 16 94762677 missense probably damaging 1.00
R7304:Kcnj6 UTSW 16 94941183 missense probably benign
R7337:Kcnj6 UTSW 16 94833214 missense probably benign 0.10
R7396:Kcnj6 UTSW 16 94762447 missense probably benign 0.31
R8543:Kcnj6 UTSW 16 94762391 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GTGATGACCCGGTAGCCATAAC -3'
(R):5'- ACCAGCCAAAGTTGCCTAAG -3'

Sequencing Primer
(F):5'- CCGGTAGCCATAACCGATG -3'
(R):5'- CTAAGCAGGCCAGGGACGAC -3'
Posted On2016-10-24