Incidental Mutation 'R5560:Olfr1436'
ID 436567
Institutional Source Beutler Lab
Gene Symbol Olfr1436
Ensembl Gene ENSMUSG00000067513
Gene Name olfactory receptor 1436
Synonyms GA_x6K02T2RE5P-2634596-2633658, MOR214-2
MMRRC Submission 043117-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R5560 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 12298183-12299130 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 12298644 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 163 (Q163*)
Ref Sequence ENSEMBL: ENSMUSP00000085113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087812]
AlphaFold A0PK57
Predicted Effect probably null
Transcript: ENSMUST00000087812
AA Change: Q163*
SMART Domains Protein: ENSMUSP00000085113
Gene: ENSMUSG00000067513
AA Change: Q163*

DomainStartEndE-ValueType
Pfam:7tm_4 35 311 2.4e-54 PFAM
Pfam:7tm_1 45 294 1.3e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 (GRCm38) E98K possibly damaging Het
Adipor1 T C 1: 134,426,040 (GRCm38) W188R possibly damaging Het
Agrn T C 4: 156,178,497 (GRCm38) D441G probably damaging Het
Ankrd55 T C 13: 112,383,490 (GRCm38) S570P probably benign Het
Ano9 C G 7: 141,110,482 (GRCm38) G80R probably damaging Het
Arhgef2 T A 3: 88,634,437 (GRCm38) V250E probably damaging Het
Atp2b2 T C 6: 113,774,358 (GRCm38) D583G possibly damaging Het
Bcar3 T A 3: 122,426,575 (GRCm38) D40E possibly damaging Het
Capn12 A G 7: 28,882,860 (GRCm38) D133G probably benign Het
Ccna1 A T 3: 55,048,569 (GRCm38) Y269N probably damaging Het
Cct6b A T 11: 82,741,413 (GRCm38) Y250N probably damaging Het
Cep112 A C 11: 108,437,235 (GRCm38) K98Q probably damaging Het
Chst13 T C 6: 90,318,269 (GRCm38) D54G probably damaging Het
Clstn2 G T 9: 97,469,819 (GRCm38) H518N possibly damaging Het
Cntnap1 T A 11: 101,182,435 (GRCm38) L581M probably damaging Het
Cog3 T A 14: 75,729,393 (GRCm38) M446L probably damaging Het
D430042O09Rik T C 7: 125,854,561 (GRCm38) V1150A probably benign Het
Dennd2c T A 3: 103,161,555 (GRCm38) I756K probably damaging Het
Dennd3 T G 15: 73,532,895 (GRCm38) L273R probably damaging Het
Dhx34 C A 7: 16,218,541 (GRCm38) R53L probably benign Het
Dnah9 G A 11: 65,881,740 (GRCm38) T3722I probably benign Het
Dnajb12 GC G 10: 59,892,752 (GRCm38) probably null Het
Dusp6 A G 10: 99,266,241 (GRCm38) Y217C probably damaging Het
Dyrk1b G A 7: 28,184,253 (GRCm38) R178Q possibly damaging Het
Eif4g1 T A 16: 20,686,895 (GRCm38) C1009S probably benign Het
Fam198a T C 9: 121,978,223 (GRCm38) F478L possibly damaging Het
Frmpd1 A T 4: 45,243,697 (GRCm38) T57S probably damaging Het
Gjc2 A G 11: 59,177,359 (GRCm38) V99A possibly damaging Het
Gm9955 A T 18: 24,709,092 (GRCm38) probably benign Het
Gpr158 A G 2: 21,826,290 (GRCm38) I734V possibly damaging Het
Herc1 A T 9: 66,451,119 (GRCm38) H2494L probably benign Het
Hist1h1c A G 13: 23,739,407 (GRCm38) S187G probably benign Het
Hjurp GT GTT 1: 88,266,524 (GRCm38) probably null Het
Hmgcs1 A G 13: 119,699,815 (GRCm38) probably null Het
Invs A T 4: 48,416,084 (GRCm38) T655S probably benign Het
Ipo9 G A 1: 135,402,245 (GRCm38) L486F probably damaging Het
Kcnj6 A T 16: 94,832,965 (GRCm38) L96M probably benign Het
Lfng A G 5: 140,614,267 (GRCm38) D354G possibly damaging Het
Lgsn T C 1: 31,196,872 (GRCm38) L139P probably damaging Het
Madd C A 2: 91,163,545 (GRCm38) V923L probably damaging Het
Mfsd7a A T 5: 108,448,863 (GRCm38) M1K probably null Het
Mical1 A T 10: 41,478,965 (GRCm38) I157F probably damaging Het
Mis18bp1 T C 12: 65,152,816 (GRCm38) N154S possibly damaging Het
Mrps14 A G 1: 160,195,535 (GRCm38) K6R probably benign Het
Mug1 T A 6: 121,861,073 (GRCm38) C421S probably damaging Het
Myo18b A G 5: 112,868,295 (GRCm38) I696T probably damaging Het
Naf1 T C 8: 66,883,545 (GRCm38) Y375H probably damaging Het
Nsf T A 11: 103,863,255 (GRCm38) E485V possibly damaging Het
Nup188 A G 2: 30,309,885 (GRCm38) D307G probably damaging Het
Ocel1 C A 8: 71,372,478 (GRCm38) P108T probably damaging Het
Oip5 A G 2: 119,613,059 (GRCm38) S177P probably damaging Het
Olfr365 A G 2: 37,201,930 (GRCm38) I230V probably benign Het
Olfr51 A C 11: 51,007,523 (GRCm38) I184L possibly damaging Het
Olfr943 A C 9: 39,184,184 (GRCm38) E2A probably benign Het
Omg A G 11: 79,501,758 (GRCm38) W425R possibly damaging Het
Pikfyve A G 1: 65,253,407 (GRCm38) Y1339C probably damaging Het
Polr3e A G 7: 120,922,949 (GRCm38) D6G possibly damaging Het
Pou4f3 C A 18: 42,395,415 (GRCm38) P141Q probably benign Het
Rcsd1 T A 1: 165,655,501 (GRCm38) N337I possibly damaging Het
Rhoj C T 12: 75,391,712 (GRCm38) P91S probably damaging Het
Rnf10 A G 5: 115,249,998 (GRCm38) F367S probably damaging Het
Rnft1 A T 11: 86,493,196 (GRCm38) R307S probably benign Het
Ryr3 A T 2: 112,754,877 (GRCm38) F2788Y probably damaging Het
Scgb1c1 A G 7: 140,846,224 (GRCm38) K78E possibly damaging Het
Scn5a G T 9: 119,560,286 (GRCm38) A123E probably damaging Het
Setd2 T A 9: 110,549,839 (GRCm38) Y623* probably null Het
Tbl2 C T 5: 135,157,591 (GRCm38) Q216* probably null Het
Thegl A G 5: 77,016,486 (GRCm38) D112G possibly damaging Het
Tnc A G 4: 64,008,709 (GRCm38) I860T probably damaging Het
Trafd1 T C 5: 121,373,303 (GRCm38) K484R possibly damaging Het
Trank1 T C 9: 111,390,567 (GRCm38) V2124A probably damaging Het
Trpm4 A T 7: 45,310,332 (GRCm38) W713R probably damaging Het
Uap1l1 T C 2: 25,362,676 (GRCm38) T451A probably benign Het
Uba6 A T 5: 86,131,260 (GRCm38) C668S probably damaging Het
Ubxn11 T C 4: 134,126,624 (GRCm38) F441S probably damaging Het
Vmn1r22 C T 6: 57,900,738 (GRCm38) V85M probably damaging Het
Vmn2r72 T A 7: 85,751,942 (GRCm38) I90L probably damaging Het
Wdr60 T C 12: 116,218,113 (GRCm38) S769G probably damaging Het
Zfp330 T C 8: 82,764,956 (GRCm38) E196G probably benign Het
Zfp746 A G 6: 48,082,174 (GRCm38) V167A possibly damaging Het
Zfp994 T C 17: 22,201,713 (GRCm38) E85G possibly damaging Het
Other mutations in Olfr1436
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Olfr1436 APN 19 12,298,785 (GRCm38) missense probably damaging 0.99
IGL02129:Olfr1436 APN 19 12,298,458 (GRCm38) missense probably damaging 1.00
PIT4378001:Olfr1436 UTSW 19 12,298,712 (GRCm38) missense probably damaging 1.00
R0727:Olfr1436 UTSW 19 12,299,094 (GRCm38) missense probably benign 0.03
R1244:Olfr1436 UTSW 19 12,298,496 (GRCm38) missense probably damaging 0.98
R1647:Olfr1436 UTSW 19 12,298,659 (GRCm38) missense probably benign
R1648:Olfr1436 UTSW 19 12,298,659 (GRCm38) missense probably benign
R1837:Olfr1436 UTSW 19 12,298,376 (GRCm38) missense probably damaging 1.00
R1899:Olfr1436 UTSW 19 12,298,343 (GRCm38) missense probably damaging 1.00
R2031:Olfr1436 UTSW 19 12,298,376 (GRCm38) missense probably damaging 1.00
R2305:Olfr1436 UTSW 19 12,299,087 (GRCm38) missense probably benign 0.01
R4624:Olfr1436 UTSW 19 12,298,983 (GRCm38) missense probably benign
R4681:Olfr1436 UTSW 19 12,299,049 (GRCm38) missense probably benign 0.05
R4790:Olfr1436 UTSW 19 12,298,941 (GRCm38) missense possibly damaging 0.60
R4865:Olfr1436 UTSW 19 12,298,580 (GRCm38) missense probably damaging 1.00
R4941:Olfr1436 UTSW 19 12,298,896 (GRCm38) missense possibly damaging 0.95
R5138:Olfr1436 UTSW 19 12,298,776 (GRCm38) missense possibly damaging 0.56
R5161:Olfr1436 UTSW 19 12,298,789 (GRCm38) missense probably damaging 0.99
R5983:Olfr1436 UTSW 19 12,299,103 (GRCm38) missense probably benign 0.00
R6736:Olfr1436 UTSW 19 12,298,572 (GRCm38) nonsense probably null
R6882:Olfr1436 UTSW 19 12,298,570 (GRCm38) missense probably damaging 1.00
R6883:Olfr1436 UTSW 19 12,298,570 (GRCm38) missense probably damaging 1.00
R7465:Olfr1436 UTSW 19 12,298,437 (GRCm38) missense probably benign 0.04
R7500:Olfr1436 UTSW 19 12,298,677 (GRCm38) missense probably damaging 0.98
R7529:Olfr1436 UTSW 19 12,298,722 (GRCm38) missense probably damaging 1.00
R7565:Olfr1436 UTSW 19 12,298,848 (GRCm38) missense probably benign 0.09
R7611:Olfr1436 UTSW 19 12,298,878 (GRCm38) missense probably damaging 0.99
R7850:Olfr1436 UTSW 19 12,298,632 (GRCm38) missense probably benign
R7956:Olfr1436 UTSW 19 12,298,302 (GRCm38) missense probably damaging 1.00
R7991:Olfr1436 UTSW 19 12,298,275 (GRCm38) missense probably damaging 1.00
R9770:Olfr1436 UTSW 19 12,299,100 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACCTACCCTTAGCTGAAGTG -3'
(R):5'- TGTGGGCTGCATAGTTCAATAC -3'

Sequencing Primer
(F):5'- GTGATCTTCAGAATGGACAAGAC -3'
(R):5'- GGGCTGCATAGTTCAATACTTTATG -3'
Posted On 2016-10-24