Incidental Mutation 'R0006:Fancl'
ID43657
Institutional Source Beutler Lab
Gene Symbol Fancl
Ensembl Gene ENSMUSG00000004018
Gene NameFanconi anemia, complementation group L
SynonymsB230118H11Rik, 2010322C19Rik, Phf9, Pog, gcd
MMRRC Submission 041980-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R0006 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location26386135-26471876 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26469695 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 316 (N316S)
Ref Sequence ENSEMBL: ENSMUSP00000004120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004120] [ENSMUST00000078362] [ENSMUST00000109504] [ENSMUST00000109509]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004120
AA Change: N316S

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000004120
Gene: ENSMUSG00000004018
AA Change: N316S

DomainStartEndE-ValueType
Pfam:WD-3 11 295 1.1e-106 PFAM
FANCL_C 303 371 7.55e-44 SMART
RING 307 362 2.77e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078362
SMART Domains Protein: ENSMUSP00000077471
Gene: ENSMUSG00000064090

DomainStartEndE-ValueType
Pfam:Pkinase 29 298 4.4e-18 PFAM
Pfam:Pkinase_Tyr 29 313 2e-11 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109504
SMART Domains Protein: ENSMUSP00000105130
Gene: ENSMUSG00000064090

DomainStartEndE-ValueType
Pfam:Pkinase 29 302 2.8e-22 PFAM
Pfam:Pkinase_Tyr 29 313 1.3e-11 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109509
AA Change: N311S

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105135
Gene: ENSMUSG00000004018
AA Change: N311S

DomainStartEndE-ValueType
Pfam:WD-3 8 290 2.4e-116 PFAM
FANCL_C 298 366 7.55e-44 SMART
RING 302 357 2.77e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000134445
AA Change: N85S
SMART Domains Protein: ENSMUSP00000119873
Gene: ENSMUSG00000004018
AA Change: N85S

DomainStartEndE-ValueType
Pfam:WD-3 1 65 2.2e-24 PFAM
Pfam:FANCL_C 73 127 4.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143471
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: This gene encodes the complementation group L subunit of the multimeric Fanconi anemia (FA) nuclear complex composed of proteins encoded by over ten Fanconi anemia complementation (FANC) group genes. The FA complex is necessary for protection against DNA damage. This gene product, an E3 ubiquitin ligase, catalyzes and is required for the monoubiquitination of the protein encoded by the Fanconi anemia, complementation group D2 gene, a critical step in the FA pathway (PMID: 12973351, 21229326). In mouse, mutations of this E3 ubiquitin ligase gene can lead to infertility in adult males and females, and a deletion of this gene can cause embryonic lethality in some genetic backgrounds. A pseudogene of this gene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygosity for mutations that inactivate the allele results in male and female infertility due to a defects in primordial germ cell proliferation. Homozygosity is embryonic lethal on some backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Fancl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00755:Fancl APN 11 26470916 missense probably benign
IGL01940:Fancl APN 11 26459752 missense probably damaging 0.99
IGL02681:Fancl APN 11 26468722 splice site probably null
IGL03063:Fancl APN 11 26387299 missense probably damaging 1.00
R0006:Fancl UTSW 11 26469695 missense possibly damaging 0.46
R0218:Fancl UTSW 11 26471337 missense probably benign 0.30
R1016:Fancl UTSW 11 26387195 unclassified probably benign
R1802:Fancl UTSW 11 26459709 missense probably benign 0.01
R2018:Fancl UTSW 11 26422459 missense probably damaging 1.00
R2121:Fancl UTSW 11 26459841 splice site probably benign
R4579:Fancl UTSW 11 26468423 splice site probably null
R5472:Fancl UTSW 11 26469677 missense probably damaging 1.00
R5495:Fancl UTSW 11 26397801 missense probably damaging 1.00
R6425:Fancl UTSW 11 26399680 missense probably damaging 1.00
R7114:Fancl UTSW 11 26407615 missense probably damaging 1.00
R7139:Fancl UTSW 11 26403358 missense probably benign 0.01
R7302:Fancl UTSW 11 26403363 missense probably damaging 0.98
R7324:Fancl UTSW 11 26403362 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCCAGCCCCAAATGAAATCTG -3'
(R):5'- TATGCAGCCTGCACAGTAGCAC -3'

Sequencing Primer
(F):5'- ATGAGACTAGGTGTTATCTCTGC -3'
(R):5'- GGGAGACTTCAGTTATACCTACC -3'
Posted On2013-05-29