Incidental Mutation 'R5561:Opn3'
ID 436574
Institutional Source Beutler Lab
Gene Symbol Opn3
Ensembl Gene ENSMUSG00000026525
Gene Name opsin 3
Synonyms Ecpn, encephalopsin, panopsin, ERO
MMRRC Submission 043118-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5561 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 175662421-175692776 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 175665587 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 137 (R137H)
Ref Sequence ENSEMBL: ENSMUSP00000027809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027809] [ENSMUST00000040250] [ENSMUST00000097458]
AlphaFold Q9WUK7
Predicted Effect probably damaging
Transcript: ENSMUST00000027809
AA Change: R137H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027809
Gene: ENSMUSG00000026525
AA Change: R137H

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Pfam:7tm_1 56 307 4.7e-36 PFAM
low complexity region 314 331 N/A INTRINSIC
low complexity region 363 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040250
SMART Domains Protein: ENSMUSP00000038914
Gene: ENSMUSG00000039783

DomainStartEndE-ValueType
Pfam:FAD_binding_3 9 328 5.6e-22 PFAM
Pfam:NAD_binding_8 13 63 2.2e-7 PFAM
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097458
SMART Domains Protein: ENSMUSP00000095067
Gene: ENSMUSG00000039783

DomainStartEndE-ValueType
Pfam:FAD_binding_3 9 328 5.8e-22 PFAM
Pfam:NAD_binding_8 13 63 2.1e-7 PFAM
transmembrane domain 391 413 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Opsins are members of the guanine nucleotide-binding protein (G protein)-coupled receptor superfamily. In addition to the visual opsins, mammals possess several photoreceptive non-visual opsins that are expressed in extraocular tissues. This gene, opsin 3, is strongly expressed in brain and testis and weakly expressed in liver, placenta, heart, lung, skeletal muscle, kidney, and pancreas. The gene may also be expressed in the retina. The protein has the canonical features of a photoreceptive opsin protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice exhibit normal photoentrainment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik C A 14: 95,882,371 A188E probably benign Het
A630095N17Rik T C 1: 75,220,537 probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrv1 A G 13: 81,476,564 L3762P probably damaging Het
Amn1 G A 6: 149,185,024 R4W probably damaging Het
Atxn1 G T 13: 45,566,871 T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 T259S probably benign Het
Bsn C G 9: 108,105,511 R3681P unknown Het
C8b T C 4: 104,784,448 Y194H possibly damaging Het
Ccdc110 T G 8: 45,940,609 S119R probably benign Het
Ceacam20 A T 7: 19,970,393 Q123L possibly damaging Het
Clip3 A G 7: 30,298,849 D240G possibly damaging Het
Col24a1 T C 3: 145,298,827 F22S probably benign Het
Dlg5 T A 14: 24,177,792 M354L probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dnase1l3 A G 14: 7,967,847 V282A probably damaging Het
Dnhd1 G A 7: 105,714,821 G4127S probably damaging Het
Eed G A 7: 89,967,793 R165W probably damaging Het
Ephb2 C T 4: 136,661,406 V627M probably damaging Het
Fancc T C 13: 63,317,387 E502G possibly damaging Het
Fbf1 T C 11: 116,157,820 D105G probably damaging Het
Fer T A 17: 64,037,585 Y246* probably null Het
Fer1l6 A G 15: 58,660,825 K1792E probably damaging Het
Foxi2 A G 7: 135,411,647 D202G probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
H2-DMb2 G T 17: 34,145,471 probably null Het
Helq G T 5: 100,787,050 D491E probably benign Het
Hgsnat A G 8: 25,946,334 V564A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st5 T A 10: 36,833,429 V320D probably damaging Het
Ifit1bl1 A T 19: 34,593,797 L420* probably null Het
Ift80 T G 3: 68,967,863 N178T probably benign Het
Ing4 C T 6: 125,047,060 T89I possibly damaging Het
Lcp1 G A 14: 75,212,508 D386N probably benign Het
Mdc1 T A 17: 35,848,546 I606K probably benign Het
Mllt10 T A 2: 18,109,845 M120K probably damaging Het
Morc1 G T 16: 48,449,348 L89F probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nav3 C A 10: 109,716,552 D1810Y probably damaging Het
Obscn G A 11: 59,036,093 T5532M probably damaging Het
Olfr527 C T 7: 140,336,152 Q97* probably null Het
Olfr716 A G 7: 107,148,090 N258S probably benign Het
Palld G A 8: 61,516,585 A993V probably damaging Het
Ppp1r12c A T 7: 4,486,356 probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Rapgef2 A T 3: 79,088,643 probably null Het
Ring1 T C 17: 34,021,458 E382G possibly damaging Het
Rpl22l1 T A 3: 28,806,820 N61K probably benign Het
Rpp14 A G 14: 8,090,558 probably null Het
Rusc2 C T 4: 43,415,932 Q413* probably null Het
Slco3a1 A G 7: 74,318,499 I491T possibly damaging Het
Smtnl1 C T 2: 84,818,395 V172I probably benign Het
Spats2l T A 1: 57,900,621 probably null Het
Spire1 T A 18: 67,506,646 N266Y probably damaging Het
Stox2 T C 8: 47,193,006 H473R probably damaging Het
Syne2 C T 12: 76,094,458 R121* probably null Het
Synrg G A 11: 84,002,240 probably null Het
Tm9sf1 C T 14: 55,638,097 V397M probably damaging Het
Trabd T C 15: 89,081,984 M48T probably benign Het
Ttn T A 2: 76,707,233 I26457F possibly damaging Het
Uggt2 C T 14: 119,041,527 R856Q probably benign Het
Ugt1a5 T A 1: 88,166,317 M89K probably benign Het
Vmn2r53 A T 7: 12,601,420 S104R probably damaging Het
Zdhhc12 A T 2: 30,092,484 L53Q probably null Het
Other mutations in Opn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0349:Opn3 UTSW 1 175692304 missense probably damaging 1.00
R0377:Opn3 UTSW 1 175663694 missense probably damaging 1.00
R2040:Opn3 UTSW 1 175663579 missense possibly damaging 0.73
R2351:Opn3 UTSW 1 175692511 missense probably benign
R4868:Opn3 UTSW 1 175663561 missense probably damaging 1.00
R6232:Opn3 UTSW 1 175663103 missense probably damaging 0.99
R6848:Opn3 UTSW 1 175663049 missense probably damaging 1.00
R7275:Opn3 UTSW 1 175665473 missense probably damaging 1.00
R7522:Opn3 UTSW 1 175665623 missense probably benign 0.08
R7774:Opn3 UTSW 1 175662905 missense probably damaging 0.99
R8081:Opn3 UTSW 1 175665569 missense probably damaging 0.96
R9205:Opn3 UTSW 1 175663089 missense probably benign 0.05
Z1177:Opn3 UTSW 1 175692663 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CGTTGGCATCCTTGGATCTC -3'
(R):5'- TTTGACCTACAATCCATGTGCC -3'

Sequencing Primer
(F):5'- GATCTCCAGTCCACGGTACAG -3'
(R):5'- CCTAATTGATTTTCCTGGGGAGCC -3'
Posted On 2016-10-24