Mutagenetix > Incidental Mutation

Incidental Mutation 'R5561:Smtnl1'

436578

Institutional Source

Beutler Lab

Gene Symbol

Smtnl1

Ensembl Gene

ENSMUSG00000027077

Gene Name

smoothelin-like 1

Synonyms

Chasm, 1110030K22Rik

MMRRC Submission

043118-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5561 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84811176-84822652 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 84818395 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 172 (V172I)

Ref Sequence

ENSEMBL: ENSMUSP00000028471 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028471]

AlphaFold

Q99LM3

PDB Structure

The Solution Structure of Calponin Homology Domain from Smoothelin-like 1 [SOLUTION NMR]
HADDOCK-derived structure of the CH-domain of the smoothelin-like 1 complexed with the C-domain of apocalmodulin [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000028471
AA Change: V172I

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000028471
Gene: ENSMUSG00000027077
AA Change: V172I

Domain	Start	End	E-Value	Type
low complexity region	56	72	N/A	INTRINSIC
coiled coil region	124	154	N/A	INTRINSIC
low complexity region	218	230	N/A	INTRINSIC
low complexity region	236	246	N/A	INTRINSIC
low complexity region	260	285	N/A	INTRINSIC
CH	345	444	5.55e-18	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the contraction of both striated and smooth muscle. During pregnancy, the encoded protein interacts with progesterone receptor to attenuate the expression of contractile and metabolic proteins. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit vascular and muscular adaptations normally found in exercised animals as well as increased exercise endurance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	C	A	14: 95,882,371	A188E	probably benign	Het
A630095N17Rik	T	C	1: 75,220,537		probably benign	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adgrv1	A	G	13: 81,476,564	L3762P	probably damaging	Het
Amn1	G	A	6: 149,185,024	R4W	probably damaging	Het
Atxn1	G	T	13: 45,566,871	T516N	possibly damaging	Het
Atxn7	A	T	14: 14,089,260	T259S	probably benign	Het
Bsn	C	G	9: 108,105,511	R3681P	unknown	Het
C8b	T	C	4: 104,784,448	Y194H	possibly damaging	Het
Ccdc110	T	G	8: 45,940,609	S119R	probably benign	Het
Ceacam20	A	T	7: 19,970,393	Q123L	possibly damaging	Het
Clip3	A	G	7: 30,298,849	D240G	possibly damaging	Het
Col24a1	T	C	3: 145,298,827	F22S	probably benign	Het
Dlg5	T	A	14: 24,177,792	M354L	probably benign	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
Dnase1l3	A	G	14: 7,967,847	V282A	probably damaging	Het
Dnhd1	G	A	7: 105,714,821	G4127S	probably damaging	Het
Eed	G	A	7: 89,967,793	R165W	probably damaging	Het
Ephb2	C	T	4: 136,661,406	V627M	probably damaging	Het
Fancc	T	C	13: 63,317,387	E502G	possibly damaging	Het
Fbf1	T	C	11: 116,157,820	D105G	probably damaging	Het
Fer	T	A	17: 64,037,585	Y246*	probably null	Het
Fer1l6	A	G	15: 58,660,825	K1792E	probably damaging	Het
Foxi2	A	G	7: 135,411,647	D202G	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
H2-DMb2	G	T	17: 34,145,471		probably null	Het
Helq	G	T	5: 100,787,050	D491E	probably benign	Het
Hgsnat	A	G	8: 25,946,334	V564A	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hs3st5	T	A	10: 36,833,429	V320D	probably damaging	Het
Ifit1bl1	A	T	19: 34,593,797	L420*	probably null	Het
Ift80	T	G	3: 68,967,863	N178T	probably benign	Het
Ing4	C	T	6: 125,047,060	T89I	possibly damaging	Het
Lcp1	G	A	14: 75,212,508	D386N	probably benign	Het
Mdc1	T	A	17: 35,848,546	I606K	probably benign	Het
Mllt10	T	A	2: 18,109,845	M120K	probably damaging	Het
Morc1	G	T	16: 48,449,348	L89F	probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Nav3	C	A	10: 109,716,552	D1810Y	probably damaging	Het
Obscn	G	A	11: 59,036,093	T5532M	probably damaging	Het
Olfr527	C	T	7: 140,336,152	Q97*	probably null	Het
Olfr716	A	G	7: 107,148,090	N258S	probably benign	Het
Opn3	C	T	1: 175,665,587	R137H	probably damaging	Het
Palld	G	A	8: 61,516,585	A993V	probably damaging	Het
Ppp1r12c	A	T	7: 4,486,356		probably null	Het
Prdm4	TCTCCTCCT	TCTCCT	10: 85,893,123		probably null	Het
Rapgef2	A	T	3: 79,088,643		probably null	Het
Ring1	T	C	17: 34,021,458	E382G	possibly damaging	Het
Rpl22l1	T	A	3: 28,806,820	N61K	probably benign	Het
Rpp14	A	G	14: 8,090,558		probably null	Het
Rusc2	C	T	4: 43,415,932	Q413*	probably null	Het
Slco3a1	A	G	7: 74,318,499	I491T	possibly damaging	Het
Spats2l	T	A	1: 57,900,621		probably null	Het
Spire1	T	A	18: 67,506,646	N266Y	probably damaging	Het
Stox2	T	C	8: 47,193,006	H473R	probably damaging	Het
Syne2	C	T	12: 76,094,458	R121*	probably null	Het
Synrg	G	A	11: 84,002,240		probably null	Het
Tm9sf1	C	T	14: 55,638,097	V397M	probably damaging	Het
Trabd	T	C	15: 89,081,984	M48T	probably benign	Het
Ttn	T	A	2: 76,707,233	I26457F	possibly damaging	Het
Uggt2	C	T	14: 119,041,527	R856Q	probably benign	Het
Ugt1a5	T	A	1: 88,166,317	M89K	probably benign	Het
Vmn2r53	A	T	7: 12,601,420	S104R	probably damaging	Het
Zdhhc12	A	T	2: 30,092,484	L53Q	probably null	Het

Other mutations in Smtnl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01135:Smtnl1	APN	2	84818887	missense	probably benign
IGL01702:Smtnl1	APN	2	84818690	missense	possibly damaging	0.71
IGL01836:Smtnl1	APN	2	84815370	missense	probably damaging	1.00
IGL01866:Smtnl1	APN	2	84818745	missense	possibly damaging	0.80
IGL01869:Smtnl1	APN	2	84811397	makesense	probably null
IGL01989:Smtnl1	APN	2	84818470	missense	probably benign	0.22
IGL02247:Smtnl1	APN	2	84817028	splice site	probably benign
R1442:Smtnl1	UTSW	2	84818436	missense	probably damaging	0.97
R4577:Smtnl1	UTSW	2	84818443	missense	possibly damaging	0.50
R5340:Smtnl1	UTSW	2	84815441	missense	probably damaging	1.00
R5524:Smtnl1	UTSW	2	84818894	missense	probably benign	0.05
R5631:Smtnl1	UTSW	2	84818754	missense	probably benign
R5997:Smtnl1	UTSW	2	84815378	missense	probably damaging	1.00
R6050:Smtnl1	UTSW	2	84811453	missense	probably damaging	1.00
R6433:Smtnl1	UTSW	2	84818368	missense	probably benign	0.03
R7011:Smtnl1	UTSW	2	84818409	missense	probably benign	0.01
R8390:Smtnl1	UTSW	2	84815350	nonsense	probably null
R8406:Smtnl1	UTSW	2	84818398	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GAGTCAGGCAGGAGTTGATTC -3'
(R):5'- AGCAGCATCTAAGAGTGGCG -3'

Sequencing Primer
(F):5'- TCAGGCAGGAGTTGATTCTAGAG -3'
(R):5'- TTCTCAGGAAGACACTGGTAAG -3'

Posted On

2016-10-24