Mutagenetix > Incidental Mutation

Incidental Mutation 'R5561:Ift80'

436580

Institutional Source

Beutler Lab

Gene Symbol

Ift80

Ensembl Gene

ENSMUSG00000027778

Gene Name

intraflagellar transport 80

Synonyms

4921524P20Rik, Wdr56

MMRRC Submission

043118-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.113) question?

Stock #

R5561 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

68892499-69004570 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 68967863 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 178 (N178T)

Ref Sequence

ENSEMBL: ENSMUSP00000118406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029347] [ENSMUST00000107812] [ENSMUST00000148031] [ENSMUST00000154741] [ENSMUST00000169064]

AlphaFold

Q8K057

Predicted Effect

probably benign
Transcript: ENSMUST00000029347
AA Change: N178T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000029347
Gene: ENSMUSG00000027778
AA Change: N178T

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	4e-9	BLAST
WD40	95	134	9.38e-5	SMART
WD40	136	176	2.75e1	SMART
WD40	177	216	1.42e-4	SMART
WD40	219	256	1.56e-1	SMART
WD40	258	297	2.75e1	SMART
low complexity region	429	440	N/A	INTRINSIC
Blast:WD40	496	533	4e-18	BLAST
low complexity region	764	772	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107812
AA Change: N178T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103442
Gene: ENSMUSG00000027778
AA Change: N178T

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	4e-9	BLAST
WD40	95	134	9.38e-5	SMART
WD40	136	176	2.75e1	SMART
WD40	177	216	1.42e-4	SMART
WD40	219	256	1.56e-1	SMART
WD40	258	297	2.75e1	SMART
low complexity region	429	440	N/A	INTRINSIC
Blast:WD40	496	533	4e-18	BLAST
low complexity region	764	772	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136448

Predicted Effect

probably benign
Transcript: ENSMUST00000148031

SMART Domains

Protein: ENSMUSP00000122919
Gene: ENSMUSG00000027778

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	3e-10	BLAST
WD40	95	134	9.38e-5	SMART
Blast:WD40	136	159	1e-8	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152502

Predicted Effect

probably benign
Transcript: ENSMUST00000154741
AA Change: N178T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000118406
Gene: ENSMUSG00000027778
AA Change: N178T

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	9e-10	BLAST
WD40	95	134	9.38e-5	SMART
WD40	136	176	2.75e1	SMART
WD40	177	209	2.12e2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169064
AA Change: N178T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133263
Gene: ENSMUSG00000027778
AA Change: N178T

Domain	Start	End	E-Value	Type
WD40	4	41	1.43e0	SMART
Blast:WD40	46	93	4e-9	BLAST
WD40	95	134	9.38e-5	SMART
WD40	136	176	2.75e1	SMART
WD40	177	216	1.42e-4	SMART
WD40	219	256	1.56e-1	SMART
WD40	258	297	2.75e1	SMART
low complexity region	429	440	N/A	INTRINSIC
Blast:WD40	496	533	4e-18	BLAST
low complexity region	764	772	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176754

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the intraflagellar transport complex B and is necessary for the function of motile and sensory cilia. Defects in this gene are a cause of asphyxiating thoracic dystrophy 2 (ATD2). Three transcript variants encoding two different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a hypomorphic gene trap allele exhibit partial perinatal lethality, decreased body size, postnatal growth retardation, shortened long bones, constricted thoracic cage, periaxial polydactyly, and small cranium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	C	A	14: 95,882,371	A188E	probably benign	Het
A630095N17Rik	T	C	1: 75,220,537		probably benign	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adgrv1	A	G	13: 81,476,564	L3762P	probably damaging	Het
Amn1	G	A	6: 149,185,024	R4W	probably damaging	Het
Atxn1	G	T	13: 45,566,871	T516N	possibly damaging	Het
Atxn7	A	T	14: 14,089,260	T259S	probably benign	Het
Bsn	C	G	9: 108,105,511	R3681P	unknown	Het
C8b	T	C	4: 104,784,448	Y194H	possibly damaging	Het
Ccdc110	T	G	8: 45,940,609	S119R	probably benign	Het
Ceacam20	A	T	7: 19,970,393	Q123L	possibly damaging	Het
Clip3	A	G	7: 30,298,849	D240G	possibly damaging	Het
Col24a1	T	C	3: 145,298,827	F22S	probably benign	Het
Dlg5	T	A	14: 24,177,792	M354L	probably benign	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
Dnase1l3	A	G	14: 7,967,847	V282A	probably damaging	Het
Dnhd1	G	A	7: 105,714,821	G4127S	probably damaging	Het
Eed	G	A	7: 89,967,793	R165W	probably damaging	Het
Ephb2	C	T	4: 136,661,406	V627M	probably damaging	Het
Fancc	T	C	13: 63,317,387	E502G	possibly damaging	Het
Fbf1	T	C	11: 116,157,820	D105G	probably damaging	Het
Fer	T	A	17: 64,037,585	Y246*	probably null	Het
Fer1l6	A	G	15: 58,660,825	K1792E	probably damaging	Het
Foxi2	A	G	7: 135,411,647	D202G	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
H2-DMb2	G	T	17: 34,145,471		probably null	Het
Helq	G	T	5: 100,787,050	D491E	probably benign	Het
Hgsnat	A	G	8: 25,946,334	V564A	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hs3st5	T	A	10: 36,833,429	V320D	probably damaging	Het
Ifit1bl1	A	T	19: 34,593,797	L420*	probably null	Het
Ing4	C	T	6: 125,047,060	T89I	possibly damaging	Het
Lcp1	G	A	14: 75,212,508	D386N	probably benign	Het
Mdc1	T	A	17: 35,848,546	I606K	probably benign	Het
Mllt10	T	A	2: 18,109,845	M120K	probably damaging	Het
Morc1	G	T	16: 48,449,348	L89F	probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Nav3	C	A	10: 109,716,552	D1810Y	probably damaging	Het
Obscn	G	A	11: 59,036,093	T5532M	probably damaging	Het
Olfr527	C	T	7: 140,336,152	Q97*	probably null	Het
Olfr716	A	G	7: 107,148,090	N258S	probably benign	Het
Opn3	C	T	1: 175,665,587	R137H	probably damaging	Het
Palld	G	A	8: 61,516,585	A993V	probably damaging	Het
Ppp1r12c	A	T	7: 4,486,356		probably null	Het
Prdm4	TCTCCTCCT	TCTCCT	10: 85,893,123		probably null	Het
Rapgef2	A	T	3: 79,088,643		probably null	Het
Ring1	T	C	17: 34,021,458	E382G	possibly damaging	Het
Rpl22l1	T	A	3: 28,806,820	N61K	probably benign	Het
Rpp14	A	G	14: 8,090,558		probably null	Het
Rusc2	C	T	4: 43,415,932	Q413*	probably null	Het
Slco3a1	A	G	7: 74,318,499	I491T	possibly damaging	Het
Smtnl1	C	T	2: 84,818,395	V172I	probably benign	Het
Spats2l	T	A	1: 57,900,621		probably null	Het
Spire1	T	A	18: 67,506,646	N266Y	probably damaging	Het
Stox2	T	C	8: 47,193,006	H473R	probably damaging	Het
Syne2	C	T	12: 76,094,458	R121*	probably null	Het
Synrg	G	A	11: 84,002,240		probably null	Het
Tm9sf1	C	T	14: 55,638,097	V397M	probably damaging	Het
Trabd	T	C	15: 89,081,984	M48T	probably benign	Het
Ttn	T	A	2: 76,707,233	I26457F	possibly damaging	Het
Uggt2	C	T	14: 119,041,527	R856Q	probably benign	Het
Ugt1a5	T	A	1: 88,166,317	M89K	probably benign	Het
Vmn2r53	A	T	7: 12,601,420	S104R	probably damaging	Het
Zdhhc12	A	T	2: 30,092,484	L53Q	probably null	Het

Other mutations in Ift80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Ift80	APN	3	68914653	nonsense	probably null
IGL01020:Ift80	APN	3	68963679	missense	probably damaging	1.00
IGL01544:Ift80	APN	3	68990782	missense	probably benign	0.05
IGL01612:Ift80	APN	3	68963663	missense	possibly damaging	0.61
IGL01743:Ift80	APN	3	68962296	missense	probably benign	0.00
IGL02187:Ift80	APN	3	68985456	missense	probably damaging	1.00
IGL02381:Ift80	APN	3	68962320	splice site	probably null
IGL02407:Ift80	APN	3	68898536	missense	probably benign
IGL02510:Ift80	APN	3	68898543	missense	probably benign	0.07
IGL02512:Ift80	APN	3	68927725	critical splice donor site	probably null
R0091:Ift80	UTSW	3	68914675	missense	probably damaging	1.00
R0212:Ift80	UTSW	3	68940173	missense	probably benign	0.05
R0348:Ift80	UTSW	3	68935899	missense	probably benign
R0357:Ift80	UTSW	3	68914653	nonsense	probably null
R1381:Ift80	UTSW	3	68914783	missense	possibly damaging	0.78
R1419:Ift80	UTSW	3	68940198	missense	probably damaging	1.00
R1643:Ift80	UTSW	3	68916157	missense	probably benign	0.06
R1899:Ift80	UTSW	3	68918513	missense	probably benign	0.00
R1926:Ift80	UTSW	3	68916165	missense	probably damaging	1.00
R2013:Ift80	UTSW	3	68990784	missense	possibly damaging	0.62
R3894:Ift80	UTSW	3	68917999	missense	probably damaging	1.00
R4214:Ift80	UTSW	3	68990808	missense	possibly damaging	0.64
R4290:Ift80	UTSW	3	68963690	missense	probably damaging	0.96
R4303:Ift80	UTSW	3	68894174	missense	probably benign	0.15
R4361:Ift80	UTSW	3	68963649	missense	probably damaging	1.00
R4576:Ift80	UTSW	3	68950530	missense	possibly damaging	0.71
R4596:Ift80	UTSW	3	68990759	missense	probably benign	0.01
R4652:Ift80	UTSW	3	68914940	missense	probably benign	0.32
R4654:Ift80	UTSW	3	68918537	missense	possibly damaging	0.94
R4720:Ift80	UTSW	3	68962290	missense	possibly damaging	0.50
R4865:Ift80	UTSW	3	68990759	missense	probably benign	0.01
R4885:Ift80	UTSW	3	68950496	missense	probably damaging	0.98
R5357:Ift80	UTSW	3	68990780	missense	possibly damaging	0.62
R5589:Ift80	UTSW	3	68930900	missense	probably damaging	1.00
R5806:Ift80	UTSW	3	68950476	missense	probably benign	0.09
R6910:Ift80	UTSW	3	68927735	missense	probably benign	0.01
R6962:Ift80	UTSW	3	68994545	start gained	probably benign
R7157:Ift80	UTSW	3	68990944	nonsense	probably null
R7452:Ift80	UTSW	3	68994282	splice site	probably null
R7504:Ift80	UTSW	3	68918005	missense	probably damaging	0.99
R8077:Ift80	UTSW	3	68916145	missense	probably benign	0.01
R8435:Ift80	UTSW	3	68985454	missense	probably damaging	1.00
R8821:Ift80	UTSW	3	68962250	missense	probably damaging	0.98
R8831:Ift80	UTSW	3	68962250	missense	probably damaging	0.98
R8897:Ift80	UTSW	3	68950476	missense	probably benign
R9222:Ift80	UTSW	3	68918561	missense	possibly damaging	0.58
R9328:Ift80	UTSW	3	68940150	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACCGGGAAAGTGAGTCTTTGG -3'
(R):5'- AGCTCAGCTTATTTATCATCCGTG -3'

Sequencing Primer
(F):5'- AGTGAGTCTTTGGGGAAACAC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'

Posted On

2016-10-24