Incidental Mutation 'R5561:Col24a1'
ID 436583
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Name collagen, type XXIV, alpha 1
Synonyms 5430404K19Rik
MMRRC Submission 043118-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5561 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 144998233-145257766 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 145004588 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 22 (F22S)
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]
AlphaFold Q30D77
Predicted Effect probably benign
Transcript: ENSMUST00000029848
AA Change: F22S

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: F22S

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Predicted Effect silent
Transcript: ENSMUST00000139001
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik T C 1: 75,197,181 (GRCm39) probably benign Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adgrv1 A G 13: 81,624,683 (GRCm39) L3762P probably damaging Het
Amn1 G A 6: 149,086,522 (GRCm39) R4W probably damaging Het
Atxn1 G T 13: 45,720,347 (GRCm39) T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 (GRCm38) T259S probably benign Het
Bsn C G 9: 107,982,710 (GRCm39) R3681P unknown Het
C8b T C 4: 104,641,645 (GRCm39) Y194H possibly damaging Het
Ccdc110 T G 8: 46,393,646 (GRCm39) S119R probably benign Het
Ccdc202 C A 14: 96,119,807 (GRCm39) A188E probably benign Het
Ceacam20 A T 7: 19,704,318 (GRCm39) Q123L possibly damaging Het
Clip3 A G 7: 29,998,274 (GRCm39) D240G possibly damaging Het
Dlg5 T A 14: 24,227,860 (GRCm39) M354L probably benign Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Dnase1l3 A G 14: 7,967,847 (GRCm38) V282A probably damaging Het
Dnhd1 G A 7: 105,364,028 (GRCm39) G4127S probably damaging Het
Eed G A 7: 89,617,001 (GRCm39) R165W probably damaging Het
Ephb2 C T 4: 136,388,717 (GRCm39) V627M probably damaging Het
Fancc T C 13: 63,465,201 (GRCm39) E502G possibly damaging Het
Fbf1 T C 11: 116,048,646 (GRCm39) D105G probably damaging Het
Fer T A 17: 64,344,580 (GRCm39) Y246* probably null Het
Fer1l6 A G 15: 58,532,674 (GRCm39) K1792E probably damaging Het
Foxi2 A G 7: 135,013,376 (GRCm39) D202G probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
H2-DMb2 G T 17: 34,364,445 (GRCm39) probably null Het
Helq G T 5: 100,934,916 (GRCm39) D491E probably benign Het
Hgsnat A G 8: 26,436,362 (GRCm39) V564A possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hs3st5 T A 10: 36,709,425 (GRCm39) V320D probably damaging Het
Ifit1bl1 A T 19: 34,571,197 (GRCm39) L420* probably null Het
Ift80 T G 3: 68,875,196 (GRCm39) N178T probably benign Het
Ing4 C T 6: 125,024,023 (GRCm39) T89I possibly damaging Het
Lcp1 G A 14: 75,449,948 (GRCm39) D386N probably benign Het
Mdc1 T A 17: 36,159,438 (GRCm39) I606K probably benign Het
Mllt10 T A 2: 18,114,656 (GRCm39) M120K probably damaging Het
Morc1 G T 16: 48,269,711 (GRCm39) L89F probably benign Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Nav3 C A 10: 109,552,413 (GRCm39) D1810Y probably damaging Het
Obscn G A 11: 58,926,919 (GRCm39) T5532M probably damaging Het
Opn3 C T 1: 175,493,153 (GRCm39) R137H probably damaging Het
Or12j2 C T 7: 139,916,065 (GRCm39) Q97* probably null Het
Or2d36 A G 7: 106,747,297 (GRCm39) N258S probably benign Het
Palld G A 8: 61,969,619 (GRCm39) A993V probably damaging Het
Ppp1r12c A T 7: 4,489,355 (GRCm39) probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,728,987 (GRCm39) probably null Het
Rapgef2 A T 3: 78,995,950 (GRCm39) probably null Het
Ring1 T C 17: 34,240,432 (GRCm39) E382G possibly damaging Het
Rpl22l1 T A 3: 28,860,969 (GRCm39) N61K probably benign Het
Rpp14 A G 14: 8,090,558 (GRCm38) probably null Het
Rusc2 C T 4: 43,415,932 (GRCm39) Q413* probably null Het
Slco3a1 A G 7: 73,968,247 (GRCm39) I491T possibly damaging Het
Smtnl1 C T 2: 84,648,739 (GRCm39) V172I probably benign Het
Spats2l T A 1: 57,939,780 (GRCm39) probably null Het
Spire1 T A 18: 67,639,716 (GRCm39) N266Y probably damaging Het
Stox2 T C 8: 47,646,041 (GRCm39) H473R probably damaging Het
Syne2 C T 12: 76,141,232 (GRCm39) R121* probably null Het
Synrg G A 11: 83,893,066 (GRCm39) probably null Het
Tm9sf1 C T 14: 55,875,554 (GRCm39) V397M probably damaging Het
Trabd T C 15: 88,966,187 (GRCm39) M48T probably benign Het
Ttn T A 2: 76,537,577 (GRCm39) I26457F possibly damaging Het
Uggt2 C T 14: 119,278,939 (GRCm39) R856Q probably benign Het
Ugt1a5 T A 1: 88,094,039 (GRCm39) M89K probably benign Het
Vmn2r53 A T 7: 12,335,347 (GRCm39) S104R probably damaging Het
Zdhhc12 A T 2: 29,982,496 (GRCm39) L53Q probably null Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145,068,064 (GRCm39) missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145,167,225 (GRCm39) missense probably benign 0.00
IGL01160:Col24a1 APN 3 145,213,468 (GRCm39) missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145,020,637 (GRCm39) missense probably benign 0.07
IGL01409:Col24a1 APN 3 145,244,319 (GRCm39) missense probably benign 0.19
IGL01587:Col24a1 APN 3 145,139,110 (GRCm39) splice site probably null
IGL01666:Col24a1 APN 3 145,050,447 (GRCm39) missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145,230,018 (GRCm39) splice site probably benign
IGL01721:Col24a1 APN 3 145,244,322 (GRCm39) missense probably benign 0.26
IGL01939:Col24a1 APN 3 145,021,005 (GRCm39) missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145,229,922 (GRCm39) splice site probably null
IGL02002:Col24a1 APN 3 145,062,699 (GRCm39) missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145,020,723 (GRCm39) missense probably benign 0.34
IGL02552:Col24a1 APN 3 145,179,962 (GRCm39) missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145,019,934 (GRCm39) missense probably benign
IGL02582:Col24a1 APN 3 145,020,247 (GRCm39) missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145,198,056 (GRCm39) nonsense probably null
IGL02942:Col24a1 APN 3 145,247,420 (GRCm39) missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145,244,458 (GRCm39) critical splice donor site probably null
IGL03108:Col24a1 APN 3 145,029,162 (GRCm39) missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145,019,744 (GRCm39) splice site probably benign
IGL03405:Col24a1 APN 3 145,020,918 (GRCm39) missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145,250,899 (GRCm39) missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145,229,897 (GRCm39) missense possibly damaging 0.94
R0502:Col24a1 UTSW 3 145,251,071 (GRCm39) splice site probably benign
R0556:Col24a1 UTSW 3 145,020,489 (GRCm39) missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 144,998,906 (GRCm39) missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145,019,881 (GRCm39) missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145,034,520 (GRCm39) missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145,166,593 (GRCm39) missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145,095,355 (GRCm39) critical splice donor site probably null
R1713:Col24a1 UTSW 3 145,072,624 (GRCm39) nonsense probably null
R1854:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145,164,895 (GRCm39) missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145,243,022 (GRCm39) critical splice donor site probably null
R1969:Col24a1 UTSW 3 145,020,691 (GRCm39) missense probably benign 0.03
R2216:Col24a1 UTSW 3 145,020,742 (GRCm39) missense probably benign 0.34
R2290:Col24a1 UTSW 3 145,218,950 (GRCm39) missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145,043,621 (GRCm39) missense probably benign 0.01
R3772:Col24a1 UTSW 3 145,251,041 (GRCm39) missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145,167,192 (GRCm39) missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145,230,037 (GRCm39) nonsense probably null
R4433:Col24a1 UTSW 3 145,020,144 (GRCm39) missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145,020,144 (GRCm39) missense probably benign 0.00
R4972:Col24a1 UTSW 3 145,215,439 (GRCm39) missense probably benign 0.42
R5157:Col24a1 UTSW 3 145,051,712 (GRCm39) nonsense probably null
R5216:Col24a1 UTSW 3 145,021,071 (GRCm39) missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145,190,433 (GRCm39) missense probably benign 0.03
R5334:Col24a1 UTSW 3 145,167,280 (GRCm39) missense possibly damaging 0.91
R5416:Col24a1 UTSW 3 145,020,786 (GRCm39) nonsense probably null
R5473:Col24a1 UTSW 3 145,243,016 (GRCm39) missense probably benign 0.41
R5538:Col24a1 UTSW 3 144,998,882 (GRCm39) missense probably damaging 0.99
R5648:Col24a1 UTSW 3 145,064,321 (GRCm39) missense probably benign 0.00
R5920:Col24a1 UTSW 3 145,133,985 (GRCm39) missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6151:Col24a1 UTSW 3 145,019,815 (GRCm39) missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145,020,141 (GRCm39) missense probably benign 0.00
R6728:Col24a1 UTSW 3 145,020,957 (GRCm39) missense probably benign
R6734:Col24a1 UTSW 3 145,214,429 (GRCm39) missense probably benign 0.06
R6861:Col24a1 UTSW 3 145,166,589 (GRCm39) missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145,020,807 (GRCm39) nonsense probably null
R7001:Col24a1 UTSW 3 145,004,627 (GRCm39) missense probably benign 0.28
R7148:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145,192,059 (GRCm39) nonsense probably null
R7315:Col24a1 UTSW 3 145,137,625 (GRCm39) missense possibly damaging 0.82
R7358:Col24a1 UTSW 3 144,998,926 (GRCm39) critical splice donor site probably null
R7371:Col24a1 UTSW 3 145,049,459 (GRCm39) missense probably benign 0.06
R7383:Col24a1 UTSW 3 145,004,599 (GRCm39) missense probably benign
R7605:Col24a1 UTSW 3 145,244,442 (GRCm39) missense possibly damaging 0.67
R7650:Col24a1 UTSW 3 145,020,214 (GRCm39) missense probably benign 0.00
R7679:Col24a1 UTSW 3 145,105,110 (GRCm39) missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145,072,656 (GRCm39) splice site probably null
R7701:Col24a1 UTSW 3 145,020,772 (GRCm39) missense probably benign
R7805:Col24a1 UTSW 3 145,019,901 (GRCm39) missense probably benign 0.02
R7913:Col24a1 UTSW 3 145,137,621 (GRCm39) nonsense probably null
R7921:Col24a1 UTSW 3 145,179,993 (GRCm39) missense probably damaging 1.00
R8056:Col24a1 UTSW 3 145,019,925 (GRCm39) missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145,213,457 (GRCm39) missense probably benign 0.31
R8294:Col24a1 UTSW 3 145,186,844 (GRCm39) missense probably null 1.00
R8305:Col24a1 UTSW 3 145,179,937 (GRCm39) missense probably benign 0.00
R8430:Col24a1 UTSW 3 145,021,060 (GRCm39) missense probably damaging 1.00
R8708:Col24a1 UTSW 3 145,251,020 (GRCm39) missense probably damaging 0.99
R8880:Col24a1 UTSW 3 145,019,798 (GRCm39) missense probably null
R9056:Col24a1 UTSW 3 145,021,009 (GRCm39) missense probably damaging 0.96
R9461:Col24a1 UTSW 3 145,186,879 (GRCm39) nonsense probably null
R9612:Col24a1 UTSW 3 145,250,960 (GRCm39) missense probably benign 0.32
R9777:Col24a1 UTSW 3 145,021,103 (GRCm39) nonsense probably null
Z1176:Col24a1 UTSW 3 145,048,259 (GRCm39) missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145,048,260 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTACTGAACACGGCTCATTCTAAA -3'
(R):5'- ACTGTTGCAAGCAGAAATGC -3'

Sequencing Primer
(F):5'- TCATTCTAAAGCGGTGGACC -3'
(R):5'- TGTGCAGCATCCGCAAATG -3'
Posted On 2016-10-24