Incidental Mutation 'R5561:Amn1'
ID 436591
Institutional Source Beutler Lab
Gene Symbol Amn1
Ensembl Gene ENSMUSG00000068250
Gene Name antagonist of mitotic exit network 1
Synonyms C730024G19Rik
MMRRC Submission 043118-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R5561 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 149059075-149090210 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 149086522 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 4 (R4W)
Ref Sequence ENSEMBL: ENSMUSP00000092957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095319] [ENSMUST00000111535] [ENSMUST00000141346]
AlphaFold B8JKV0
Predicted Effect probably damaging
Transcript: ENSMUST00000095319
AA Change: R4W

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092957
Gene: ENSMUSG00000068250
AA Change: R4W

DomainStartEndE-ValueType
LRR 17 41 2.82e0 SMART
LRR 42 70 1.52e2 SMART
LRR 71 96 1.25e-1 SMART
LRR 97 122 3.89e-3 SMART
LRR 123 147 1.44e1 SMART
LRR 150 175 1.28e1 SMART
Blast:LRR 176 204 3e-10 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111535
AA Change: R47W

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107160
Gene: ENSMUSG00000068250
AA Change: R47W

DomainStartEndE-ValueType
LRR 60 84 2.82e0 SMART
LRR 85 113 1.52e2 SMART
LRR 114 139 1.25e-1 SMART
LRR 140 165 3.89e-3 SMART
LRR 166 190 1.44e1 SMART
LRR 193 218 1.28e1 SMART
Blast:LRR 219 247 4e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134181
Predicted Effect probably damaging
Transcript: ENSMUST00000141346
AA Change: R4W

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116060
Gene: ENSMUSG00000068250
AA Change: R4W

DomainStartEndE-ValueType
LRR 17 41 2.82e0 SMART
LRR 42 70 1.52e2 SMART
LRR 71 96 1.25e-1 SMART
LRR 97 121 1.44e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203043
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204681
Predicted Effect probably benign
Transcript: ENSMUST00000156864
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik T C 1: 75,197,181 (GRCm39) probably benign Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adgrv1 A G 13: 81,624,683 (GRCm39) L3762P probably damaging Het
Atxn1 G T 13: 45,720,347 (GRCm39) T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 (GRCm38) T259S probably benign Het
Bsn C G 9: 107,982,710 (GRCm39) R3681P unknown Het
C8b T C 4: 104,641,645 (GRCm39) Y194H possibly damaging Het
Ccdc110 T G 8: 46,393,646 (GRCm39) S119R probably benign Het
Ccdc202 C A 14: 96,119,807 (GRCm39) A188E probably benign Het
Ceacam20 A T 7: 19,704,318 (GRCm39) Q123L possibly damaging Het
Clip3 A G 7: 29,998,274 (GRCm39) D240G possibly damaging Het
Col24a1 T C 3: 145,004,588 (GRCm39) F22S probably benign Het
Dlg5 T A 14: 24,227,860 (GRCm39) M354L probably benign Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Dnase1l3 A G 14: 7,967,847 (GRCm38) V282A probably damaging Het
Dnhd1 G A 7: 105,364,028 (GRCm39) G4127S probably damaging Het
Eed G A 7: 89,617,001 (GRCm39) R165W probably damaging Het
Ephb2 C T 4: 136,388,717 (GRCm39) V627M probably damaging Het
Fancc T C 13: 63,465,201 (GRCm39) E502G possibly damaging Het
Fbf1 T C 11: 116,048,646 (GRCm39) D105G probably damaging Het
Fer T A 17: 64,344,580 (GRCm39) Y246* probably null Het
Fer1l6 A G 15: 58,532,674 (GRCm39) K1792E probably damaging Het
Foxi2 A G 7: 135,013,376 (GRCm39) D202G probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
H2-DMb2 G T 17: 34,364,445 (GRCm39) probably null Het
Helq G T 5: 100,934,916 (GRCm39) D491E probably benign Het
Hgsnat A G 8: 26,436,362 (GRCm39) V564A possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hs3st5 T A 10: 36,709,425 (GRCm39) V320D probably damaging Het
Ifit1bl1 A T 19: 34,571,197 (GRCm39) L420* probably null Het
Ift80 T G 3: 68,875,196 (GRCm39) N178T probably benign Het
Ing4 C T 6: 125,024,023 (GRCm39) T89I possibly damaging Het
Lcp1 G A 14: 75,449,948 (GRCm39) D386N probably benign Het
Mdc1 T A 17: 36,159,438 (GRCm39) I606K probably benign Het
Mllt10 T A 2: 18,114,656 (GRCm39) M120K probably damaging Het
Morc1 G T 16: 48,269,711 (GRCm39) L89F probably benign Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Nav3 C A 10: 109,552,413 (GRCm39) D1810Y probably damaging Het
Obscn G A 11: 58,926,919 (GRCm39) T5532M probably damaging Het
Opn3 C T 1: 175,493,153 (GRCm39) R137H probably damaging Het
Or12j2 C T 7: 139,916,065 (GRCm39) Q97* probably null Het
Or2d36 A G 7: 106,747,297 (GRCm39) N258S probably benign Het
Palld G A 8: 61,969,619 (GRCm39) A993V probably damaging Het
Ppp1r12c A T 7: 4,489,355 (GRCm39) probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,728,987 (GRCm39) probably null Het
Rapgef2 A T 3: 78,995,950 (GRCm39) probably null Het
Ring1 T C 17: 34,240,432 (GRCm39) E382G possibly damaging Het
Rpl22l1 T A 3: 28,860,969 (GRCm39) N61K probably benign Het
Rpp14 A G 14: 8,090,558 (GRCm38) probably null Het
Rusc2 C T 4: 43,415,932 (GRCm39) Q413* probably null Het
Slco3a1 A G 7: 73,968,247 (GRCm39) I491T possibly damaging Het
Smtnl1 C T 2: 84,648,739 (GRCm39) V172I probably benign Het
Spats2l T A 1: 57,939,780 (GRCm39) probably null Het
Spire1 T A 18: 67,639,716 (GRCm39) N266Y probably damaging Het
Stox2 T C 8: 47,646,041 (GRCm39) H473R probably damaging Het
Syne2 C T 12: 76,141,232 (GRCm39) R121* probably null Het
Synrg G A 11: 83,893,066 (GRCm39) probably null Het
Tm9sf1 C T 14: 55,875,554 (GRCm39) V397M probably damaging Het
Trabd T C 15: 88,966,187 (GRCm39) M48T probably benign Het
Ttn T A 2: 76,537,577 (GRCm39) I26457F possibly damaging Het
Uggt2 C T 14: 119,278,939 (GRCm39) R856Q probably benign Het
Ugt1a5 T A 1: 88,094,039 (GRCm39) M89K probably benign Het
Vmn2r53 A T 7: 12,335,347 (GRCm39) S104R probably damaging Het
Zdhhc12 A T 2: 29,982,496 (GRCm39) L53Q probably null Het
Other mutations in Amn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02391:Amn1 APN 6 149,070,944 (GRCm39) critical splice donor site probably null
PIT4453001:Amn1 UTSW 6 149,072,357 (GRCm39) missense probably benign 0.00
R0153:Amn1 UTSW 6 149,090,091 (GRCm39) utr 5 prime probably benign
R0494:Amn1 UTSW 6 149,086,634 (GRCm39) unclassified probably benign
R0557:Amn1 UTSW 6 149,072,503 (GRCm39) missense possibly damaging 0.50
R0717:Amn1 UTSW 6 149,084,970 (GRCm39) missense possibly damaging 0.88
R0736:Amn1 UTSW 6 149,084,970 (GRCm39) missense possibly damaging 0.88
R3420:Amn1 UTSW 6 149,070,950 (GRCm39) nonsense probably null
R3421:Amn1 UTSW 6 149,070,950 (GRCm39) nonsense probably null
R4466:Amn1 UTSW 6 149,068,343 (GRCm39) splice site probably null
R4760:Amn1 UTSW 6 149,086,611 (GRCm39) missense probably benign
R5294:Amn1 UTSW 6 149,086,622 (GRCm39) unclassified probably benign
R5356:Amn1 UTSW 6 149,068,392 (GRCm39) missense possibly damaging 0.80
R7501:Amn1 UTSW 6 149,086,529 (GRCm39) missense probably benign 0.19
R7564:Amn1 UTSW 6 149,086,529 (GRCm39) missense probably benign 0.19
R7643:Amn1 UTSW 6 149,086,529 (GRCm39) missense probably benign 0.19
R7645:Amn1 UTSW 6 149,086,529 (GRCm39) missense probably benign 0.19
R8097:Amn1 UTSW 6 149,070,853 (GRCm39) unclassified probably benign
R9390:Amn1 UTSW 6 149,084,983 (GRCm39) missense probably damaging 1.00
R9565:Amn1 UTSW 6 149,090,103 (GRCm39) start gained probably benign
X0064:Amn1 UTSW 6 149,072,533 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCAAGGATGAGCACTGGC -3'
(R):5'- GGCAGTGATTATGAATGTCATCAAG -3'

Sequencing Primer
(F):5'- GCACTGGCTTTTCAAGTCAAAGTC -3'
(R):5'- GTCTTATGAAAGGACTAAGTGCTGAC -3'
Posted On 2016-10-24