Incidental Mutation 'R5561:Clip3'
ID 436595
Institutional Source Beutler Lab
Gene Symbol Clip3
Ensembl Gene ENSMUSG00000013921
Gene Name CAP-GLY domain containing linker protein 3
Synonyms
MMRRC Submission 043118-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.700) question?
Stock # R5561 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 30291728-30308367 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30298849 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 240 (D240G)
Ref Sequence ENSEMBL: ENSMUSP00000014065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014065] [ENSMUST00000126216] [ENSMUST00000144508] [ENSMUST00000150892]
AlphaFold B9EHT4
PDB Structure Solution structure of the 2nd CAP-Gly domain in mouse CLIP170-related 59kDa protein CLIPR-59 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014065
AA Change: D240G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000014065
Gene: ENSMUSG00000013921
AA Change: D240G

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
ANK 117 155 1.04e2 SMART
ANK 160 191 3.74e0 SMART
ANK 197 226 3.54e-1 SMART
CAP_GLY 296 361 2.16e-33 SMART
low complexity region 367 379 N/A INTRINSIC
low complexity region 387 408 N/A INTRINSIC
CAP_GLY 418 483 1.4e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125935
Predicted Effect probably benign
Transcript: ENSMUST00000126216
SMART Domains Protein: ENSMUSP00000123660
Gene: ENSMUSG00000013921

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144508
SMART Domains Protein: ENSMUSP00000121276
Gene: ENSMUSG00000013921

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150892
SMART Domains Protein: ENSMUSP00000123164
Gene: ENSMUSG00000013921

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
SCOP:d1sw6a_ 102 129 4e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytoplasmic linker protein 170 family. Members of this protein family contain a cytoskeleton-associated protein glycine-rich domain and mediate the interaction of microtubules with cellular organelles. The encoded protein plays a role in T cell apoptosis by facilitating the association of tubulin and the lipid raft ganglioside GD3. The encoded protein also functions as a scaffold protein mediating membrane localization of phosphorylated protein kinase B. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired phrenic nerve-elicited muscle contraction, defects in diaphragm innervation, altered neuromuscular junction stability, abnormal motor innervation of other muscles, and complete neonatal lethality due to respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik C A 14: 95,882,371 A188E probably benign Het
A630095N17Rik T C 1: 75,220,537 probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrv1 A G 13: 81,476,564 L3762P probably damaging Het
Amn1 G A 6: 149,185,024 R4W probably damaging Het
Atxn1 G T 13: 45,566,871 T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 T259S probably benign Het
Bsn C G 9: 108,105,511 R3681P unknown Het
C8b T C 4: 104,784,448 Y194H possibly damaging Het
Ccdc110 T G 8: 45,940,609 S119R probably benign Het
Ceacam20 A T 7: 19,970,393 Q123L possibly damaging Het
Col24a1 T C 3: 145,298,827 F22S probably benign Het
Dlg5 T A 14: 24,177,792 M354L probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dnase1l3 A G 14: 7,967,847 V282A probably damaging Het
Dnhd1 G A 7: 105,714,821 G4127S probably damaging Het
Eed G A 7: 89,967,793 R165W probably damaging Het
Ephb2 C T 4: 136,661,406 V627M probably damaging Het
Fancc T C 13: 63,317,387 E502G possibly damaging Het
Fbf1 T C 11: 116,157,820 D105G probably damaging Het
Fer T A 17: 64,037,585 Y246* probably null Het
Fer1l6 A G 15: 58,660,825 K1792E probably damaging Het
Foxi2 A G 7: 135,411,647 D202G probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
H2-DMb2 G T 17: 34,145,471 probably null Het
Helq G T 5: 100,787,050 D491E probably benign Het
Hgsnat A G 8: 25,946,334 V564A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st5 T A 10: 36,833,429 V320D probably damaging Het
Ifit1bl1 A T 19: 34,593,797 L420* probably null Het
Ift80 T G 3: 68,967,863 N178T probably benign Het
Ing4 C T 6: 125,047,060 T89I possibly damaging Het
Lcp1 G A 14: 75,212,508 D386N probably benign Het
Mdc1 T A 17: 35,848,546 I606K probably benign Het
Mllt10 T A 2: 18,109,845 M120K probably damaging Het
Morc1 G T 16: 48,449,348 L89F probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nav3 C A 10: 109,716,552 D1810Y probably damaging Het
Obscn G A 11: 59,036,093 T5532M probably damaging Het
Olfr527 C T 7: 140,336,152 Q97* probably null Het
Olfr716 A G 7: 107,148,090 N258S probably benign Het
Opn3 C T 1: 175,665,587 R137H probably damaging Het
Palld G A 8: 61,516,585 A993V probably damaging Het
Ppp1r12c A T 7: 4,486,356 probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Rapgef2 A T 3: 79,088,643 probably null Het
Ring1 T C 17: 34,021,458 E382G possibly damaging Het
Rpl22l1 T A 3: 28,806,820 N61K probably benign Het
Rpp14 A G 14: 8,090,558 probably null Het
Rusc2 C T 4: 43,415,932 Q413* probably null Het
Slco3a1 A G 7: 74,318,499 I491T possibly damaging Het
Smtnl1 C T 2: 84,818,395 V172I probably benign Het
Spats2l T A 1: 57,900,621 probably null Het
Spire1 T A 18: 67,506,646 N266Y probably damaging Het
Stox2 T C 8: 47,193,006 H473R probably damaging Het
Syne2 C T 12: 76,094,458 R121* probably null Het
Synrg G A 11: 84,002,240 probably null Het
Tm9sf1 C T 14: 55,638,097 V397M probably damaging Het
Trabd T C 15: 89,081,984 M48T probably benign Het
Ttn T A 2: 76,707,233 I26457F possibly damaging Het
Uggt2 C T 14: 119,041,527 R856Q probably benign Het
Ugt1a5 T A 1: 88,166,317 M89K probably benign Het
Vmn2r53 A T 7: 12,601,420 S104R probably damaging Het
Zdhhc12 A T 2: 30,092,484 L53Q probably null Het
Other mutations in Clip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Clip3 APN 7 30298862 missense probably benign 0.11
IGL01642:Clip3 APN 7 30297069 splice site probably benign
IGL03004:Clip3 APN 7 30292364 missense probably damaging 1.00
R0152:Clip3 UTSW 7 30303432 missense probably benign 0.15
R1474:Clip3 UTSW 7 30298882 missense possibly damaging 0.57
R1778:Clip3 UTSW 7 30297436 missense probably damaging 1.00
R5024:Clip3 UTSW 7 30292219 unclassified probably benign
R5908:Clip3 UTSW 7 30296873 missense probably damaging 0.99
R5912:Clip3 UTSW 7 30298870 missense probably benign 0.22
R5941:Clip3 UTSW 7 30292306 missense probably damaging 1.00
R7283:Clip3 UTSW 7 30305812 missense probably damaging 1.00
R7471:Clip3 UTSW 7 30301952 missense possibly damaging 0.89
R7516:Clip3 UTSW 7 30298843 missense possibly damaging 0.90
R9259:Clip3 UTSW 7 30298950 missense probably benign 0.31
Z1176:Clip3 UTSW 7 30298838 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGTCACATCTGCATCTTTACC -3'
(R):5'- TGACCTTCTGCCCATCAAGG -3'

Sequencing Primer
(F):5'- ATTTCCTCCTCTTCCCAAATTGACG -3'
(R):5'- AAGGAGCACTCTGTCTCCTAG -3'
Posted On 2016-10-24