Incidental Mutation 'R5561:Olfr716'
ID436599
Institutional Source Beutler Lab
Gene Symbol Olfr716
Ensembl Gene ENSMUSG00000073896
Gene Nameolfactory receptor 716
SynonymsGA_x6K02T2PBJ9-9497411-9498355, MOR260-2
MMRRC Submission 043118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5561 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location107138327-107150581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107148090 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 258 (N258S)
Ref Sequence ENSEMBL: ENSMUSP00000150175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098137] [ENSMUST00000209942] [ENSMUST00000210474] [ENSMUST00000213367] [ENSMUST00000214819] [ENSMUST00000215284] [ENSMUST00000216871]
Predicted Effect probably benign
Transcript: ENSMUST00000098137
AA Change: N258S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095740
Gene: ENSMUSG00000073896
AA Change: N258S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.4e-57 PFAM
Pfam:7tm_1 41 290 3.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209942
Predicted Effect probably benign
Transcript: ENSMUST00000210474
Predicted Effect probably benign
Transcript: ENSMUST00000213367
AA Change: N258S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000214819
AA Change: N258S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000215284
AA Change: N258S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000216871
AA Change: N258S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik C A 14: 95,882,371 A188E probably benign Het
A630095N17Rik T C 1: 75,220,537 probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrv1 A G 13: 81,476,564 L3762P probably damaging Het
Amn1 G A 6: 149,185,024 R4W probably damaging Het
Atxn1 G T 13: 45,566,871 T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 T259S probably benign Het
Bsn C G 9: 108,105,511 R3681P unknown Het
C8b T C 4: 104,784,448 Y194H possibly damaging Het
Ccdc110 T G 8: 45,940,609 S119R probably benign Het
Ceacam20 A T 7: 19,970,393 Q123L possibly damaging Het
Clip3 A G 7: 30,298,849 D240G possibly damaging Het
Col24a1 T C 3: 145,298,827 F22S probably benign Het
Dlg5 T A 14: 24,177,792 M354L probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dnase1l3 A G 14: 7,967,847 V282A probably damaging Het
Dnhd1 G A 7: 105,714,821 G4127S probably damaging Het
Eed G A 7: 89,967,793 R165W probably damaging Het
Ephb2 C T 4: 136,661,406 V627M probably damaging Het
Fancc T C 13: 63,317,387 E502G possibly damaging Het
Fbf1 T C 11: 116,157,820 D105G probably damaging Het
Fer T A 17: 64,037,585 Y246* probably null Het
Fer1l6 A G 15: 58,660,825 K1792E probably damaging Het
Foxi2 A G 7: 135,411,647 D202G probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
H2-DMb2 G T 17: 34,145,471 probably null Het
Helq G T 5: 100,787,050 D491E probably benign Het
Hgsnat A G 8: 25,946,334 V564A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st5 T A 10: 36,833,429 V320D probably damaging Het
Ifit1bl1 A T 19: 34,593,797 L420* probably null Het
Ift80 T G 3: 68,967,863 N178T probably benign Het
Ing4 C T 6: 125,047,060 T89I possibly damaging Het
Lcp1 G A 14: 75,212,508 D386N probably benign Het
Mdc1 T A 17: 35,848,546 I606K probably benign Het
Mllt10 T A 2: 18,109,845 M120K probably damaging Het
Morc1 G T 16: 48,449,348 L89F probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nav3 C A 10: 109,716,552 D1810Y probably damaging Het
Obscn G A 11: 59,036,093 T5532M probably damaging Het
Olfr527 C T 7: 140,336,152 Q97* probably null Het
Opn3 C T 1: 175,665,587 R137H probably damaging Het
Palld G A 8: 61,516,585 A993V probably damaging Het
Ppp1r12c A T 7: 4,486,356 probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Rapgef2 A T 3: 79,088,643 probably null Het
Ring1 T C 17: 34,021,458 E382G possibly damaging Het
Rpl22l1 T A 3: 28,806,820 N61K probably benign Het
Rpp14 A G 14: 8,090,558 probably null Het
Rusc2 C T 4: 43,415,932 Q413* probably null Het
Slco3a1 A G 7: 74,318,499 I491T possibly damaging Het
Smtnl1 C T 2: 84,818,395 V172I probably benign Het
Spats2l T A 1: 57,900,621 probably null Het
Spire1 T A 18: 67,506,646 N266Y probably damaging Het
Stox2 T C 8: 47,193,006 H473R probably damaging Het
Syne2 C T 12: 76,094,458 R121* probably null Het
Synrg G A 11: 84,002,240 probably null Het
Tm9sf1 C T 14: 55,638,097 V397M probably damaging Het
Trabd T C 15: 89,081,984 M48T probably benign Het
Ttn T A 2: 76,707,233 I26457F possibly damaging Het
Uggt2 C T 14: 119,041,527 R856Q probably benign Het
Ugt1a5 T A 1: 88,166,317 M89K probably benign Het
Vmn2r53 A T 7: 12,601,420 S104R probably damaging Het
Zdhhc12 A T 2: 30,092,484 L53Q probably null Het
Other mutations in Olfr716
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01781:Olfr716 APN 7 107147696 missense probably damaging 1.00
IGL02792:Olfr716 APN 7 107148218 missense probably benign 0.00
IGL03300:Olfr716 APN 7 107147409 missense probably damaging 1.00
R0071:Olfr716 UTSW 7 107147712 missense probably damaging 1.00
R0071:Olfr716 UTSW 7 107147712 missense probably damaging 1.00
R0391:Olfr716 UTSW 7 107148187 nonsense probably null
R0962:Olfr716 UTSW 7 107148087 missense possibly damaging 0.94
R1440:Olfr716 UTSW 7 107148198 missense probably damaging 1.00
R5700:Olfr716 UTSW 7 107147541 missense probably benign
R5997:Olfr716 UTSW 7 107147328 missense possibly damaging 0.79
R6262:Olfr716 UTSW 7 107147711 missense probably damaging 1.00
R6922:Olfr716 UTSW 7 107148083 missense probably damaging 0.98
R7076:Olfr716 UTSW 7 107148029 missense probably damaging 1.00
R8025:Olfr716 UTSW 7 107147723 missense possibly damaging 0.87
Z1088:Olfr716 UTSW 7 107148212 missense probably benign
Z1176:Olfr716 UTSW 7 107148155 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GGCCATCTTTGCAATGGGTG -3'
(R):5'- CTGCCCCATTTTCAAAGATGTTACC -3'

Sequencing Primer
(F):5'- GGTGTGGTAATCCTCCTAGCAC -3'
(R):5'- CCCTATAGGTCATTGCTTTCGAAAG -3'
Posted On2016-10-24