Mutagenetix > Incidental Mutation

Incidental Mutation 'R5561:Hgsnat'

436602

Institutional Source

Beutler Lab

Gene Symbol

Hgsnat

Ensembl Gene

ENSMUSG00000037260

Gene Name

heparan-alpha-glucosaminide N-acetyltransferase

Synonyms

D8Ertd354e, 9430010M12Rik, Tmem76

MMRRC Submission

043118-MU

Accession Numbers

Ncbi RefSeq: NM_029884.1; MGI:1196297

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5561 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

25944453-25976753 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25946334 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 564 (V564A)

Ref Sequence

ENSEMBL: ENSMUSP00000040356 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037609]

AlphaFold

Q3UDW8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037609
AA Change: V564A

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000040356
Gene: ENSMUSG00000037260
AA Change: V564A

Domain	Start	End	E-Value	Type
low complexity region	2	23	N/A	INTRINSIC
transmembrane domain	33	55	N/A	INTRINSIC
transmembrane domain	189	211	N/A	INTRINSIC
Pfam:DUF1624	260	434	6.8e-11	PFAM
Pfam:DUF5009	286	389	2.4e-10	PFAM
transmembrane domain	494	516	N/A	INTRINSIC
transmembrane domain	523	545	N/A	INTRINSIC
transmembrane domain	560	582	N/A	INTRINSIC
transmembrane domain	587	609	N/A	INTRINSIC
transmembrane domain	629	648	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210894

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal acetyltransferase, which is one of several enzymes involved in the lysosomal degradation of heparin sulfate. Mutations in this gene are associated with Sanfilippo syndrome C, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit progressive storage pathology in the CNS and peripheral organs, glycosaminoglycan accumulation in brain and most somatic organs, lysosomal distension and dysfunction, astrocytosis, microgliosis, hepatosplenomegaly, behavioral deficits and premature death. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted(3) Gene trapped(6)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	C	A	14: 95,882,371	A188E	probably benign	Het
A630095N17Rik	T	C	1: 75,220,537		probably benign	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adgrv1	A	G	13: 81,476,564	L3762P	probably damaging	Het
Amn1	G	A	6: 149,185,024	R4W	probably damaging	Het
Atxn1	G	T	13: 45,566,871	T516N	possibly damaging	Het
Atxn7	A	T	14: 14,089,260	T259S	probably benign	Het
Bsn	C	G	9: 108,105,511	R3681P	unknown	Het
C8b	T	C	4: 104,784,448	Y194H	possibly damaging	Het
Ccdc110	T	G	8: 45,940,609	S119R	probably benign	Het
Ceacam20	A	T	7: 19,970,393	Q123L	possibly damaging	Het
Clip3	A	G	7: 30,298,849	D240G	possibly damaging	Het
Col24a1	T	C	3: 145,298,827	F22S	probably benign	Het
Dlg5	T	A	14: 24,177,792	M354L	probably benign	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
Dnase1l3	A	G	14: 7,967,847	V282A	probably damaging	Het
Dnhd1	G	A	7: 105,714,821	G4127S	probably damaging	Het
Eed	G	A	7: 89,967,793	R165W	probably damaging	Het
Ephb2	C	T	4: 136,661,406	V627M	probably damaging	Het
Fancc	T	C	13: 63,317,387	E502G	possibly damaging	Het
Fbf1	T	C	11: 116,157,820	D105G	probably damaging	Het
Fer	T	A	17: 64,037,585	Y246*	probably null	Het
Fer1l6	A	G	15: 58,660,825	K1792E	probably damaging	Het
Foxi2	A	G	7: 135,411,647	D202G	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
H2-DMb2	G	T	17: 34,145,471		probably null	Het
Helq	G	T	5: 100,787,050	D491E	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hs3st5	T	A	10: 36,833,429	V320D	probably damaging	Het
Ifit1bl1	A	T	19: 34,593,797	L420*	probably null	Het
Ift80	T	G	3: 68,967,863	N178T	probably benign	Het
Ing4	C	T	6: 125,047,060	T89I	possibly damaging	Het
Lcp1	G	A	14: 75,212,508	D386N	probably benign	Het
Mdc1	T	A	17: 35,848,546	I606K	probably benign	Het
Mllt10	T	A	2: 18,109,845	M120K	probably damaging	Het
Morc1	G	T	16: 48,449,348	L89F	probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Nav3	C	A	10: 109,716,552	D1810Y	probably damaging	Het
Obscn	G	A	11: 59,036,093	T5532M	probably damaging	Het
Olfr527	C	T	7: 140,336,152	Q97*	probably null	Het
Olfr716	A	G	7: 107,148,090	N258S	probably benign	Het
Opn3	C	T	1: 175,665,587	R137H	probably damaging	Het
Palld	G	A	8: 61,516,585	A993V	probably damaging	Het
Ppp1r12c	A	T	7: 4,486,356		probably null	Het
Prdm4	TCTCCTCCT	TCTCCT	10: 85,893,123		probably null	Het
Rapgef2	A	T	3: 79,088,643		probably null	Het
Ring1	T	C	17: 34,021,458	E382G	possibly damaging	Het
Rpl22l1	T	A	3: 28,806,820	N61K	probably benign	Het
Rpp14	A	G	14: 8,090,558		probably null	Het
Rusc2	C	T	4: 43,415,932	Q413*	probably null	Het
Slco3a1	A	G	7: 74,318,499	I491T	possibly damaging	Het
Smtnl1	C	T	2: 84,818,395	V172I	probably benign	Het
Spats2l	T	A	1: 57,900,621		probably null	Het
Spire1	T	A	18: 67,506,646	N266Y	probably damaging	Het
Stox2	T	C	8: 47,193,006	H473R	probably damaging	Het
Syne2	C	T	12: 76,094,458	R121*	probably null	Het
Synrg	G	A	11: 84,002,240		probably null	Het
Tm9sf1	C	T	14: 55,638,097	V397M	probably damaging	Het
Trabd	T	C	15: 89,081,984	M48T	probably benign	Het
Ttn	T	A	2: 76,707,233	I26457F	possibly damaging	Het
Uggt2	C	T	14: 119,041,527	R856Q	probably benign	Het
Ugt1a5	T	A	1: 88,166,317	M89K	probably benign	Het
Vmn2r53	A	T	7: 12,601,420	S104R	probably damaging	Het
Zdhhc12	A	T	2: 30,092,484	L53Q	probably null	Het

Other mutations in Hgsnat

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00661:Hgsnat	APN	8	25972937	missense	probably benign	0.04
IGL02950:Hgsnat	APN	8	25971701	missense	probably damaging	1.00
IGL03145:Hgsnat	APN	8	25946452	missense	probably damaging	1.00
ample	UTSW	8	25947960	nonsense	probably null
generous	UTSW	8	25968361	critical splice donor site	probably null
P0018:Hgsnat	UTSW	8	25968354	unclassified	probably benign
PIT4305001:Hgsnat	UTSW	8	25945199	missense	possibly damaging	0.67
R1396:Hgsnat	UTSW	8	25957335	missense	possibly damaging	0.95
R1676:Hgsnat	UTSW	8	25954605	critical splice donor site	probably null
R1856:Hgsnat	UTSW	8	25957256	missense	probably benign	0.06
R1998:Hgsnat	UTSW	8	25945252	nonsense	probably null
R2497:Hgsnat	UTSW	8	25945252	nonsense	probably null
R2570:Hgsnat	UTSW	8	25945252	nonsense	probably null
R4012:Hgsnat	UTSW	8	25955789	nonsense	probably null
R4080:Hgsnat	UTSW	8	25946343	missense	probably benign	0.02
R4462:Hgsnat	UTSW	8	25954636	missense	probably damaging	1.00
R4523:Hgsnat	UTSW	8	25968361	critical splice donor site	probably null
R4914:Hgsnat	UTSW	8	25964838	missense	probably damaging	0.98
R5010:Hgsnat	UTSW	8	25947960	nonsense	probably null
R5889:Hgsnat	UTSW	8	25963367	missense	probably damaging	1.00
R6411:Hgsnat	UTSW	8	25946275	missense	possibly damaging	0.88
R6520:Hgsnat	UTSW	8	25953300	missense	probably damaging	1.00
R6524:Hgsnat	UTSW	8	25945232	missense	probably damaging	1.00
R7230:Hgsnat	UTSW	8	25954832	splice site	probably null
R7462:Hgsnat	UTSW	8	25957213	missense	probably benign	0.45
R7509:Hgsnat	UTSW	8	25955726	missense	probably damaging	0.98
R7526:Hgsnat	UTSW	8	25971049	missense	probably damaging	1.00
R7583:Hgsnat	UTSW	8	25971564	critical splice donor site	probably null
R7679:Hgsnat	UTSW	8	25954637	missense	probably damaging	1.00
R8111:Hgsnat	UTSW	8	25968412	missense	probably benign	0.00
R8206:Hgsnat	UTSW	8	25954637	missense	probably damaging	1.00
R8321:Hgsnat	UTSW	8	25971151	missense	possibly damaging	0.89
R8545:Hgsnat	UTSW	8	25955679	missense	probably benign	0.00
R8556:Hgsnat	UTSW	8	25953280	critical splice donor site	probably null
R9071:Hgsnat	UTSW	8	25946274	missense	possibly damaging	0.76
R9480:Hgsnat	UTSW	8	25952001	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GCTTCCTGGAAATGTGTCTCTAG -3'
(R):5'- AACATCCTTCTTTCCTTCATAGGGG -3'

Sequencing Primer
(F):5'- GTCTCTAGACAGAGCTCCAGC -3'
(R):5'- CCTTCATAGGGGCTTATTTCTATTG -3'

Posted On

2016-10-24