Incidental Mutation 'R5561:Hgsnat'
ID 436602
Institutional Source Beutler Lab
Gene Symbol Hgsnat
Ensembl Gene ENSMUSG00000037260
Gene Name heparan-alpha-glucosaminide N-acetyltransferase
Synonyms 9430010M12Rik, D8Ertd354e, Tmem76
MMRRC Submission 043118-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5561 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 26434481-26466781 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 26436362 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 564 (V564A)
Ref Sequence ENSEMBL: ENSMUSP00000040356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037609]
AlphaFold Q3UDW8
Predicted Effect possibly damaging
Transcript: ENSMUST00000037609
AA Change: V564A

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040356
Gene: ENSMUSG00000037260
AA Change: V564A

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
Pfam:DUF1624 260 434 6.8e-11 PFAM
Pfam:DUF5009 286 389 2.4e-10 PFAM
transmembrane domain 494 516 N/A INTRINSIC
transmembrane domain 523 545 N/A INTRINSIC
transmembrane domain 560 582 N/A INTRINSIC
transmembrane domain 587 609 N/A INTRINSIC
transmembrane domain 629 648 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210894
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal acetyltransferase, which is one of several enzymes involved in the lysosomal degradation of heparin sulfate. Mutations in this gene are associated with Sanfilippo syndrome C, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit progressive storage pathology in the CNS and peripheral organs, glycosaminoglycan accumulation in brain and most somatic organs, lysosomal distension and dysfunction, astrocytosis, microgliosis, hepatosplenomegaly, behavioral deficits and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(3) Gene trapped(6)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik T C 1: 75,197,181 (GRCm39) probably benign Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adgrv1 A G 13: 81,624,683 (GRCm39) L3762P probably damaging Het
Amn1 G A 6: 149,086,522 (GRCm39) R4W probably damaging Het
Atxn1 G T 13: 45,720,347 (GRCm39) T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 (GRCm38) T259S probably benign Het
Bsn C G 9: 107,982,710 (GRCm39) R3681P unknown Het
C8b T C 4: 104,641,645 (GRCm39) Y194H possibly damaging Het
Ccdc110 T G 8: 46,393,646 (GRCm39) S119R probably benign Het
Ccdc202 C A 14: 96,119,807 (GRCm39) A188E probably benign Het
Ceacam20 A T 7: 19,704,318 (GRCm39) Q123L possibly damaging Het
Clip3 A G 7: 29,998,274 (GRCm39) D240G possibly damaging Het
Col24a1 T C 3: 145,004,588 (GRCm39) F22S probably benign Het
Dlg5 T A 14: 24,227,860 (GRCm39) M354L probably benign Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Dnase1l3 A G 14: 7,967,847 (GRCm38) V282A probably damaging Het
Dnhd1 G A 7: 105,364,028 (GRCm39) G4127S probably damaging Het
Eed G A 7: 89,617,001 (GRCm39) R165W probably damaging Het
Ephb2 C T 4: 136,388,717 (GRCm39) V627M probably damaging Het
Fancc T C 13: 63,465,201 (GRCm39) E502G possibly damaging Het
Fbf1 T C 11: 116,048,646 (GRCm39) D105G probably damaging Het
Fer T A 17: 64,344,580 (GRCm39) Y246* probably null Het
Fer1l6 A G 15: 58,532,674 (GRCm39) K1792E probably damaging Het
Foxi2 A G 7: 135,013,376 (GRCm39) D202G probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
H2-DMb2 G T 17: 34,364,445 (GRCm39) probably null Het
Helq G T 5: 100,934,916 (GRCm39) D491E probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hs3st5 T A 10: 36,709,425 (GRCm39) V320D probably damaging Het
Ifit1bl1 A T 19: 34,571,197 (GRCm39) L420* probably null Het
Ift80 T G 3: 68,875,196 (GRCm39) N178T probably benign Het
Ing4 C T 6: 125,024,023 (GRCm39) T89I possibly damaging Het
Lcp1 G A 14: 75,449,948 (GRCm39) D386N probably benign Het
Mdc1 T A 17: 36,159,438 (GRCm39) I606K probably benign Het
Mllt10 T A 2: 18,114,656 (GRCm39) M120K probably damaging Het
Morc1 G T 16: 48,269,711 (GRCm39) L89F probably benign Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Nav3 C A 10: 109,552,413 (GRCm39) D1810Y probably damaging Het
Obscn G A 11: 58,926,919 (GRCm39) T5532M probably damaging Het
Opn3 C T 1: 175,493,153 (GRCm39) R137H probably damaging Het
Or12j2 C T 7: 139,916,065 (GRCm39) Q97* probably null Het
Or2d36 A G 7: 106,747,297 (GRCm39) N258S probably benign Het
Palld G A 8: 61,969,619 (GRCm39) A993V probably damaging Het
Ppp1r12c A T 7: 4,489,355 (GRCm39) probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,728,987 (GRCm39) probably null Het
Rapgef2 A T 3: 78,995,950 (GRCm39) probably null Het
Ring1 T C 17: 34,240,432 (GRCm39) E382G possibly damaging Het
Rpl22l1 T A 3: 28,860,969 (GRCm39) N61K probably benign Het
Rpp14 A G 14: 8,090,558 (GRCm38) probably null Het
Rusc2 C T 4: 43,415,932 (GRCm39) Q413* probably null Het
Slco3a1 A G 7: 73,968,247 (GRCm39) I491T possibly damaging Het
Smtnl1 C T 2: 84,648,739 (GRCm39) V172I probably benign Het
Spats2l T A 1: 57,939,780 (GRCm39) probably null Het
Spire1 T A 18: 67,639,716 (GRCm39) N266Y probably damaging Het
Stox2 T C 8: 47,646,041 (GRCm39) H473R probably damaging Het
Syne2 C T 12: 76,141,232 (GRCm39) R121* probably null Het
Synrg G A 11: 83,893,066 (GRCm39) probably null Het
Tm9sf1 C T 14: 55,875,554 (GRCm39) V397M probably damaging Het
Trabd T C 15: 88,966,187 (GRCm39) M48T probably benign Het
Ttn T A 2: 76,537,577 (GRCm39) I26457F possibly damaging Het
Uggt2 C T 14: 119,278,939 (GRCm39) R856Q probably benign Het
Ugt1a5 T A 1: 88,094,039 (GRCm39) M89K probably benign Het
Vmn2r53 A T 7: 12,335,347 (GRCm39) S104R probably damaging Het
Zdhhc12 A T 2: 29,982,496 (GRCm39) L53Q probably null Het
Other mutations in Hgsnat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Hgsnat APN 8 26,462,965 (GRCm39) missense probably benign 0.04
IGL02950:Hgsnat APN 8 26,461,729 (GRCm39) missense probably damaging 1.00
IGL03145:Hgsnat APN 8 26,436,480 (GRCm39) missense probably damaging 1.00
ample UTSW 8 26,437,988 (GRCm39) nonsense probably null
generous UTSW 8 26,458,389 (GRCm39) critical splice donor site probably null
P0018:Hgsnat UTSW 8 26,458,382 (GRCm39) unclassified probably benign
PIT4305001:Hgsnat UTSW 8 26,435,227 (GRCm39) missense possibly damaging 0.67
R1396:Hgsnat UTSW 8 26,447,363 (GRCm39) missense possibly damaging 0.95
R1676:Hgsnat UTSW 8 26,444,633 (GRCm39) critical splice donor site probably null
R1856:Hgsnat UTSW 8 26,447,284 (GRCm39) missense probably benign 0.06
R1998:Hgsnat UTSW 8 26,435,280 (GRCm39) nonsense probably null
R2497:Hgsnat UTSW 8 26,435,280 (GRCm39) nonsense probably null
R2570:Hgsnat UTSW 8 26,435,280 (GRCm39) nonsense probably null
R4012:Hgsnat UTSW 8 26,445,817 (GRCm39) nonsense probably null
R4080:Hgsnat UTSW 8 26,436,371 (GRCm39) missense probably benign 0.02
R4462:Hgsnat UTSW 8 26,444,664 (GRCm39) missense probably damaging 1.00
R4523:Hgsnat UTSW 8 26,458,389 (GRCm39) critical splice donor site probably null
R4914:Hgsnat UTSW 8 26,454,866 (GRCm39) missense probably damaging 0.98
R5010:Hgsnat UTSW 8 26,437,988 (GRCm39) nonsense probably null
R5889:Hgsnat UTSW 8 26,453,395 (GRCm39) missense probably damaging 1.00
R6411:Hgsnat UTSW 8 26,436,303 (GRCm39) missense possibly damaging 0.88
R6520:Hgsnat UTSW 8 26,443,328 (GRCm39) missense probably damaging 1.00
R6524:Hgsnat UTSW 8 26,435,260 (GRCm39) missense probably damaging 1.00
R7230:Hgsnat UTSW 8 26,444,860 (GRCm39) splice site probably null
R7462:Hgsnat UTSW 8 26,447,241 (GRCm39) missense probably benign 0.45
R7509:Hgsnat UTSW 8 26,445,754 (GRCm39) missense probably damaging 0.98
R7526:Hgsnat UTSW 8 26,461,077 (GRCm39) missense probably damaging 1.00
R7583:Hgsnat UTSW 8 26,461,592 (GRCm39) critical splice donor site probably null
R7679:Hgsnat UTSW 8 26,444,665 (GRCm39) missense probably damaging 1.00
R8111:Hgsnat UTSW 8 26,458,440 (GRCm39) missense probably benign 0.00
R8206:Hgsnat UTSW 8 26,444,665 (GRCm39) missense probably damaging 1.00
R8321:Hgsnat UTSW 8 26,461,179 (GRCm39) missense possibly damaging 0.89
R8545:Hgsnat UTSW 8 26,445,707 (GRCm39) missense probably benign 0.00
R8556:Hgsnat UTSW 8 26,443,308 (GRCm39) critical splice donor site probably null
R9071:Hgsnat UTSW 8 26,436,302 (GRCm39) missense possibly damaging 0.76
R9480:Hgsnat UTSW 8 26,442,029 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCTTCCTGGAAATGTGTCTCTAG -3'
(R):5'- AACATCCTTCTTTCCTTCATAGGGG -3'

Sequencing Primer
(F):5'- GTCTCTAGACAGAGCTCCAGC -3'
(R):5'- CCTTCATAGGGGCTTATTTCTATTG -3'
Posted On 2016-10-24