Incidental Mutation 'R5561:Ccdc110'
ID436603
Institutional Source Beutler Lab
Gene Symbol Ccdc110
Ensembl Gene ENSMUSG00000071104
Gene Namecoiled-coil domain containing 110
SynonymsLOC212392
MMRRC Submission 043118-MU
Accession Numbers

Genbank: NM_001033246; MGI: 2685018

Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5561 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location45934619-45944145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 45940609 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 119 (S119R)
Ref Sequence ENSEMBL: ENSMUSP00000092964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095326] [ENSMUST00000174815]
Predicted Effect probably benign
Transcript: ENSMUST00000095326
AA Change: S119R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000092964
Gene: ENSMUSG00000071104
AA Change: S119R

DomainStartEndE-ValueType
coiled coil region 442 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174815
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik C A 14: 95,882,371 A188E probably benign Het
A630095N17Rik T C 1: 75,220,537 probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrv1 A G 13: 81,476,564 L3762P probably damaging Het
Amn1 G A 6: 149,185,024 R4W probably damaging Het
Atxn1 G T 13: 45,566,871 T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 T259S probably benign Het
Bsn C G 9: 108,105,511 R3681P unknown Het
C8b T C 4: 104,784,448 Y194H possibly damaging Het
Ceacam20 A T 7: 19,970,393 Q123L possibly damaging Het
Clip3 A G 7: 30,298,849 D240G possibly damaging Het
Col24a1 T C 3: 145,298,827 F22S probably benign Het
Dlg5 T A 14: 24,177,792 M354L probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dnase1l3 A G 14: 7,967,847 V282A probably damaging Het
Dnhd1 G A 7: 105,714,821 G4127S probably damaging Het
Eed G A 7: 89,967,793 R165W probably damaging Het
Ephb2 C T 4: 136,661,406 V627M probably damaging Het
Fancc T C 13: 63,317,387 E502G possibly damaging Het
Fbf1 T C 11: 116,157,820 D105G probably damaging Het
Fer T A 17: 64,037,585 Y246* probably null Het
Fer1l6 A G 15: 58,660,825 K1792E probably damaging Het
Foxi2 A G 7: 135,411,647 D202G probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
H2-DMb2 G T 17: 34,145,471 probably null Het
Helq G T 5: 100,787,050 D491E probably benign Het
Hgsnat A G 8: 25,946,334 V564A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st5 T A 10: 36,833,429 V320D probably damaging Het
Ifit1bl1 A T 19: 34,593,797 L420* probably null Het
Ift80 T G 3: 68,967,863 N178T probably benign Het
Ing4 C T 6: 125,047,060 T89I possibly damaging Het
Lcp1 G A 14: 75,212,508 D386N probably benign Het
Mdc1 T A 17: 35,848,546 I606K probably benign Het
Mllt10 T A 2: 18,109,845 M120K probably damaging Het
Morc1 G T 16: 48,449,348 L89F probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nav3 C A 10: 109,716,552 D1810Y probably damaging Het
Obscn G A 11: 59,036,093 T5532M probably damaging Het
Olfr527 C T 7: 140,336,152 Q97* probably null Het
Olfr716 A G 7: 107,148,090 N258S probably benign Het
Opn3 C T 1: 175,665,587 R137H probably damaging Het
Palld G A 8: 61,516,585 A993V probably damaging Het
Ppp1r12c A T 7: 4,486,356 probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Rapgef2 A T 3: 79,088,643 probably null Het
Ring1 T C 17: 34,021,458 E382G possibly damaging Het
Rpl22l1 T A 3: 28,806,820 N61K probably benign Het
Rpp14 A G 14: 8,090,558 probably null Het
Rusc2 C T 4: 43,415,932 Q413* probably null Het
Slco3a1 A G 7: 74,318,499 I491T possibly damaging Het
Smtnl1 C T 2: 84,818,395 V172I probably benign Het
Spats2l T A 1: 57,900,621 probably null Het
Spire1 T A 18: 67,506,646 N266Y probably damaging Het
Stox2 T C 8: 47,193,006 H473R probably damaging Het
Syne2 C T 12: 76,094,458 R121* probably null Het
Synrg G A 11: 84,002,240 probably null Het
Tm9sf1 C T 14: 55,638,097 V397M probably damaging Het
Trabd T C 15: 89,081,984 M48T probably benign Het
Ttn T A 2: 76,707,233 I26457F possibly damaging Het
Uggt2 C T 14: 119,041,527 R856Q probably benign Het
Ugt1a5 T A 1: 88,166,317 M89K probably benign Het
Vmn2r53 A T 7: 12,601,420 S104R probably damaging Het
Zdhhc12 A T 2: 30,092,484 L53Q probably null Het
Other mutations in Ccdc110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01898:Ccdc110 APN 8 45942124 missense possibly damaging 0.76
IGL02175:Ccdc110 APN 8 45940623 missense probably benign 0.07
IGL02471:Ccdc110 APN 8 45941756 missense probably benign 0.14
IGL02524:Ccdc110 APN 8 45941942 missense probably benign
IGL02887:Ccdc110 APN 8 45943184 missense probably benign 0.01
IGL03227:Ccdc110 APN 8 45941549 missense probably damaging 1.00
IGL03238:Ccdc110 APN 8 45941822 missense probably benign 0.00
droll UTSW 8 45942827 missense probably benign 0.10
humorless UTSW 8 45943450 missense probably benign 0.03
R0049:Ccdc110 UTSW 8 45942626 missense probably damaging 1.00
R0049:Ccdc110 UTSW 8 45942626 missense probably damaging 1.00
R0110:Ccdc110 UTSW 8 45935157 missense probably benign 0.00
R0189:Ccdc110 UTSW 8 45935082 missense probably damaging 0.98
R0218:Ccdc110 UTSW 8 45934724 splice site probably benign
R0280:Ccdc110 UTSW 8 45943450 missense probably benign 0.03
R0332:Ccdc110 UTSW 8 45942964 nonsense probably null
R0371:Ccdc110 UTSW 8 45942806 missense possibly damaging 0.86
R0469:Ccdc110 UTSW 8 45935157 missense probably benign 0.00
R0502:Ccdc110 UTSW 8 45934724 splice site probably benign
R0510:Ccdc110 UTSW 8 45935157 missense probably benign 0.00
R0534:Ccdc110 UTSW 8 45935138 missense possibly damaging 0.73
R0647:Ccdc110 UTSW 8 45943388 missense probably damaging 0.99
R0714:Ccdc110 UTSW 8 45943010 missense possibly damaging 0.71
R0721:Ccdc110 UTSW 8 45941989 missense probably benign
R1029:Ccdc110 UTSW 8 45941780 missense probably damaging 0.98
R1147:Ccdc110 UTSW 8 45944084 missense possibly damaging 0.64
R1147:Ccdc110 UTSW 8 45944084 missense possibly damaging 0.64
R1170:Ccdc110 UTSW 8 45941885 missense probably benign 0.22
R1340:Ccdc110 UTSW 8 45942181 missense probably benign 0.02
R1540:Ccdc110 UTSW 8 45942325 nonsense probably null
R1587:Ccdc110 UTSW 8 45941746 missense probably benign 0.01
R1602:Ccdc110 UTSW 8 45938918 missense probably benign 0.12
R1629:Ccdc110 UTSW 8 45942127 missense probably benign 0.08
R1842:Ccdc110 UTSW 8 45940568 missense probably damaging 1.00
R1933:Ccdc110 UTSW 8 45943250 missense probably damaging 1.00
R1934:Ccdc110 UTSW 8 45943250 missense probably damaging 1.00
R2006:Ccdc110 UTSW 8 45943312 missense probably damaging 1.00
R2043:Ccdc110 UTSW 8 45942827 missense probably benign 0.10
R2093:Ccdc110 UTSW 8 45942077 missense probably damaging 1.00
R2165:Ccdc110 UTSW 8 45942839 missense probably benign 0.00
R3613:Ccdc110 UTSW 8 45942806 missense possibly damaging 0.86
R3923:Ccdc110 UTSW 8 45942389 missense probably damaging 1.00
R4648:Ccdc110 UTSW 8 45942668 missense possibly damaging 0.95
R4773:Ccdc110 UTSW 8 45943208 missense probably damaging 1.00
R4901:Ccdc110 UTSW 8 45943400 missense probably benign 0.35
R4911:Ccdc110 UTSW 8 45942907 missense probably benign 0.00
R4923:Ccdc110 UTSW 8 45943423 missense probably benign 0.29
R5104:Ccdc110 UTSW 8 45942692 missense probably damaging 0.99
R5966:Ccdc110 UTSW 8 45942536 missense probably damaging 1.00
R5976:Ccdc110 UTSW 8 45943499 missense possibly damaging 0.71
R6141:Ccdc110 UTSW 8 45941770 missense possibly damaging 0.89
R6326:Ccdc110 UTSW 8 45942041 missense probably damaging 1.00
R6366:Ccdc110 UTSW 8 45943388 missense probably damaging 0.99
R6405:Ccdc110 UTSW 8 45941697 nonsense probably null
R6482:Ccdc110 UTSW 8 45942788 missense probably benign 0.00
R6815:Ccdc110 UTSW 8 45941987 missense probably benign 0.19
R7387:Ccdc110 UTSW 8 45942196 missense probably benign 0.00
R7680:Ccdc110 UTSW 8 45941651 missense possibly damaging 0.64
R8099:Ccdc110 UTSW 8 45942093 missense probably damaging 1.00
R8114:Ccdc110 UTSW 8 45943103 missense probably damaging 1.00
R8151:Ccdc110 UTSW 8 45942793 missense probably damaging 1.00
R8295:Ccdc110 UTSW 8 45943379 missense probably damaging 0.97
X0053:Ccdc110 UTSW 8 45942961 missense possibly damaging 0.56
X0054:Ccdc110 UTSW 8 45941843 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGTTCCGATGATAGATGTC -3'
(R):5'- TGCCTCTCTTAAAGGGATGGTC -3'

Sequencing Primer
(F):5'- CCCCTCTAAAATTGCAAATGTAGTTC -3'
(R):5'- TGGTCAAATTTTACAGTATAGAGAGC -3'
Posted On2016-10-24