Mutagenetix > Incidental Mutation

Incidental Mutation 'R5561:Stox2'

436604

Institutional Source

Beutler Lab

Gene Symbol

Stox2

Ensembl Gene

ENSMUSG00000038143

Gene Name

storkhead box 2

Synonyms

MMRRC Submission

043118-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.173) question?

Stock #

R5561 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

47180048-47446362 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 47193006 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 473 (H473R)

Ref Sequence

ENSEMBL: ENSMUSP00000147477 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079195] [ENSMUST00000110367] [ENSMUST00000209337] [ENSMUST00000210030] [ENSMUST00000210153] [ENSMUST00000211737] [ENSMUST00000211882]

AlphaFold

Q499E5

Predicted Effect

probably damaging
Transcript: ENSMUST00000079195
AA Change: H473R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078190
Gene: ENSMUSG00000038143
AA Change: H473R

Domain	Start	End	E-Value	Type
low complexity region	15	30	N/A	INTRINSIC
Pfam:Stork_head	63	141	4.5e-35	PFAM
low complexity region	225	236	N/A	INTRINSIC
low complexity region	352	377	N/A	INTRINSIC
low complexity region	459	473	N/A	INTRINSIC
low complexity region	654	674	N/A	INTRINSIC
low complexity region	717	731	N/A	INTRINSIC
low complexity region	783	795	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110367
AA Change: H411R

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105996
Gene: ENSMUSG00000038143
AA Change: H411R

Domain	Start	End	E-Value	Type
Pfam:Stork_head	1	79	5.6e-35	PFAM
low complexity region	163	174	N/A	INTRINSIC
low complexity region	290	315	N/A	INTRINSIC
low complexity region	397	411	N/A	INTRINSIC
low complexity region	592	612	N/A	INTRINSIC
low complexity region	655	669	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000209337

Predicted Effect

possibly damaging
Transcript: ENSMUST00000210030
AA Change: H411R

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

probably benign
Transcript: ENSMUST00000210153

Predicted Effect

probably damaging
Transcript: ENSMUST00000211737
AA Change: H473R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211882
AA Change: H537R

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Storkhead-box_winged-helix domain containing protein. This protein is differentially expressed in decidual tissue and may be involved in the susceptibility to pre-eclampsia with fetal growth restriction. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	C	A	14: 95,882,371	A188E	probably benign	Het
A630095N17Rik	T	C	1: 75,220,537		probably benign	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adgrv1	A	G	13: 81,476,564	L3762P	probably damaging	Het
Amn1	G	A	6: 149,185,024	R4W	probably damaging	Het
Atxn1	G	T	13: 45,566,871	T516N	possibly damaging	Het
Atxn7	A	T	14: 14,089,260	T259S	probably benign	Het
Bsn	C	G	9: 108,105,511	R3681P	unknown	Het
C8b	T	C	4: 104,784,448	Y194H	possibly damaging	Het
Ccdc110	T	G	8: 45,940,609	S119R	probably benign	Het
Ceacam20	A	T	7: 19,970,393	Q123L	possibly damaging	Het
Clip3	A	G	7: 30,298,849	D240G	possibly damaging	Het
Col24a1	T	C	3: 145,298,827	F22S	probably benign	Het
Dlg5	T	A	14: 24,177,792	M354L	probably benign	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
Dnase1l3	A	G	14: 7,967,847	V282A	probably damaging	Het
Dnhd1	G	A	7: 105,714,821	G4127S	probably damaging	Het
Eed	G	A	7: 89,967,793	R165W	probably damaging	Het
Ephb2	C	T	4: 136,661,406	V627M	probably damaging	Het
Fancc	T	C	13: 63,317,387	E502G	possibly damaging	Het
Fbf1	T	C	11: 116,157,820	D105G	probably damaging	Het
Fer	T	A	17: 64,037,585	Y246*	probably null	Het
Fer1l6	A	G	15: 58,660,825	K1792E	probably damaging	Het
Foxi2	A	G	7: 135,411,647	D202G	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
H2-DMb2	G	T	17: 34,145,471		probably null	Het
Helq	G	T	5: 100,787,050	D491E	probably benign	Het
Hgsnat	A	G	8: 25,946,334	V564A	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hs3st5	T	A	10: 36,833,429	V320D	probably damaging	Het
Ifit1bl1	A	T	19: 34,593,797	L420*	probably null	Het
Ift80	T	G	3: 68,967,863	N178T	probably benign	Het
Ing4	C	T	6: 125,047,060	T89I	possibly damaging	Het
Lcp1	G	A	14: 75,212,508	D386N	probably benign	Het
Mdc1	T	A	17: 35,848,546	I606K	probably benign	Het
Mllt10	T	A	2: 18,109,845	M120K	probably damaging	Het
Morc1	G	T	16: 48,449,348	L89F	probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Nav3	C	A	10: 109,716,552	D1810Y	probably damaging	Het
Obscn	G	A	11: 59,036,093	T5532M	probably damaging	Het
Olfr527	C	T	7: 140,336,152	Q97*	probably null	Het
Olfr716	A	G	7: 107,148,090	N258S	probably benign	Het
Opn3	C	T	1: 175,665,587	R137H	probably damaging	Het
Palld	G	A	8: 61,516,585	A993V	probably damaging	Het
Ppp1r12c	A	T	7: 4,486,356		probably null	Het
Prdm4	TCTCCTCCT	TCTCCT	10: 85,893,123		probably null	Het
Rapgef2	A	T	3: 79,088,643		probably null	Het
Ring1	T	C	17: 34,021,458	E382G	possibly damaging	Het
Rpl22l1	T	A	3: 28,806,820	N61K	probably benign	Het
Rpp14	A	G	14: 8,090,558		probably null	Het
Rusc2	C	T	4: 43,415,932	Q413*	probably null	Het
Slco3a1	A	G	7: 74,318,499	I491T	possibly damaging	Het
Smtnl1	C	T	2: 84,818,395	V172I	probably benign	Het
Spats2l	T	A	1: 57,900,621		probably null	Het
Spire1	T	A	18: 67,506,646	N266Y	probably damaging	Het
Syne2	C	T	12: 76,094,458	R121*	probably null	Het
Synrg	G	A	11: 84,002,240		probably null	Het
Tm9sf1	C	T	14: 55,638,097	V397M	probably damaging	Het
Trabd	T	C	15: 89,081,984	M48T	probably benign	Het
Ttn	T	A	2: 76,707,233	I26457F	possibly damaging	Het
Uggt2	C	T	14: 119,041,527	R856Q	probably benign	Het
Ugt1a5	T	A	1: 88,166,317	M89K	probably benign	Het
Vmn2r53	A	T	7: 12,601,420	S104R	probably damaging	Het
Zdhhc12	A	T	2: 30,092,484	L53Q	probably null	Het

Other mutations in Stox2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02234:Stox2	APN	8	47193612	missense	probably damaging	1.00
IGL02331:Stox2	APN	8	47191944	missense	probably damaging	0.96
IGL02399:Stox2	APN	8	47186538	missense	probably damaging	0.99
IGL03091:Stox2	APN	8	47193187	missense	possibly damaging	0.66
IGL03143:Stox2	APN	8	47193804	missense	possibly damaging	0.78
IGL03307:Stox2	APN	8	47194030	missense	probably damaging	1.00
R0082:Stox2	UTSW	8	47203282	splice site	probably benign
R0313:Stox2	UTSW	8	47192134	missense	probably damaging	1.00
R0382:Stox2	UTSW	8	47203284	splice site	probably benign
R0513:Stox2	UTSW	8	47193865	missense	probably damaging	1.00
R0539:Stox2	UTSW	8	47194035	missense	probably damaging	0.97
R0920:Stox2	UTSW	8	47193018	missense	probably damaging	1.00
R1764:Stox2	UTSW	8	47194016	nonsense	probably null
R1923:Stox2	UTSW	8	47193626	missense	probably damaging	1.00
R2311:Stox2	UTSW	8	47191978	missense	probably damaging	1.00
R3196:Stox2	UTSW	8	47192830	missense	probably damaging	0.99
R3715:Stox2	UTSW	8	47413152	missense	possibly damaging	0.90
R4300:Stox2	UTSW	8	47193992	nonsense	probably null
R4534:Stox2	UTSW	8	47193379	missense	probably damaging	1.00
R4600:Stox2	UTSW	8	47192935	missense	probably damaging	1.00
R4601:Stox2	UTSW	8	47192935	missense	probably damaging	1.00
R4602:Stox2	UTSW	8	47192935	missense	probably damaging	1.00
R4603:Stox2	UTSW	8	47192935	missense	probably damaging	1.00
R4610:Stox2	UTSW	8	47192935	missense	probably damaging	1.00
R4624:Stox2	UTSW	8	47193816	missense	probably damaging	1.00
R4672:Stox2	UTSW	8	47192106	missense	probably damaging	1.00
R4888:Stox2	UTSW	8	47203163	missense	probably damaging	1.00
R4944:Stox2	UTSW	8	47413265	missense	possibly damaging	0.46
R5331:Stox2	UTSW	8	47413627	utr 5 prime	probably benign
R5349:Stox2	UTSW	8	47287916	missense	possibly damaging	0.70
R5367:Stox2	UTSW	8	47203225	missense	probably damaging	1.00
R5471:Stox2	UTSW	8	47193513	missense	probably damaging	0.96
R5630:Stox2	UTSW	8	47191890	missense	probably damaging	1.00
R5719:Stox2	UTSW	8	47413137	nonsense	probably null
R5733:Stox2	UTSW	8	47413137	nonsense	probably null
R5996:Stox2	UTSW	8	47203147	missense	possibly damaging	0.93
R6170:Stox2	UTSW	8	47192020	missense	probably benign	0.02
R6458:Stox2	UTSW	8	47192044	missense	possibly damaging	0.66
R6786:Stox2	UTSW	8	47186465	missense	probably damaging	1.00
R6815:Stox2	UTSW	8	47193101	missense	probably damaging	1.00
R6951:Stox2	UTSW	8	47203132	missense	probably damaging	1.00
R7193:Stox2	UTSW	8	47186454	missense	probably benign
R7330:Stox2	UTSW	8	47192236	missense	possibly damaging	0.61
R7552:Stox2	UTSW	8	47203119	critical splice donor site	probably null
R8001:Stox2	UTSW	8	47186477	missense	probably benign	0.06
R8266:Stox2	UTSW	8	47192025	missense	probably damaging	0.99
R8506:Stox2	UTSW	8	47192073	missense	possibly damaging	0.79
R8935:Stox2	UTSW	8	47192860	missense	possibly damaging	0.66
R9261:Stox2	UTSW	8	47192406	missense	possibly damaging	0.78
R9325:Stox2	UTSW	8	47194060	missense	probably benign	0.45
R9505:Stox2	UTSW	8	47192269	missense	probably benign	0.28
X0027:Stox2	UTSW	8	47193840	missense	possibly damaging	0.95
Z1177:Stox2	UTSW	8	47194050	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGATGACCAATCGTTTGCG -3'
(R):5'- GGGCTGCTTCATCATTGAACAC -3'

Sequencing Primer
(F):5'- TTGCGCAGGCCTTAAAGTAC -3'
(R):5'- CTGCTTCATCATTGAACACAAAGGG -3'

Posted On

2016-10-24