Incidental Mutation 'R5561:Stox2'
ID 436604
Institutional Source Beutler Lab
Gene Symbol Stox2
Ensembl Gene ENSMUSG00000038143
Gene Name storkhead box 2
Synonyms
MMRRC Submission 043118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock # R5561 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 47180048-47446362 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 47193006 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 473 (H473R)
Ref Sequence ENSEMBL: ENSMUSP00000147477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079195] [ENSMUST00000110367] [ENSMUST00000209337] [ENSMUST00000210030] [ENSMUST00000210153] [ENSMUST00000211737] [ENSMUST00000211882]
AlphaFold Q499E5
Predicted Effect probably damaging
Transcript: ENSMUST00000079195
AA Change: H473R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078190
Gene: ENSMUSG00000038143
AA Change: H473R

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Pfam:Stork_head 63 141 4.5e-35 PFAM
low complexity region 225 236 N/A INTRINSIC
low complexity region 352 377 N/A INTRINSIC
low complexity region 459 473 N/A INTRINSIC
low complexity region 654 674 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110367
AA Change: H411R

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105996
Gene: ENSMUSG00000038143
AA Change: H411R

DomainStartEndE-ValueType
Pfam:Stork_head 1 79 5.6e-35 PFAM
low complexity region 163 174 N/A INTRINSIC
low complexity region 290 315 N/A INTRINSIC
low complexity region 397 411 N/A INTRINSIC
low complexity region 592 612 N/A INTRINSIC
low complexity region 655 669 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209337
Predicted Effect possibly damaging
Transcript: ENSMUST00000210030
AA Change: H411R

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000210153
Predicted Effect probably damaging
Transcript: ENSMUST00000211737
AA Change: H473R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211882
AA Change: H537R

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Storkhead-box_winged-helix domain containing protein. This protein is differentially expressed in decidual tissue and may be involved in the susceptibility to pre-eclampsia with fetal growth restriction. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik C A 14: 95,882,371 A188E probably benign Het
A630095N17Rik T C 1: 75,220,537 probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrv1 A G 13: 81,476,564 L3762P probably damaging Het
Amn1 G A 6: 149,185,024 R4W probably damaging Het
Atxn1 G T 13: 45,566,871 T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 T259S probably benign Het
Bsn C G 9: 108,105,511 R3681P unknown Het
C8b T C 4: 104,784,448 Y194H possibly damaging Het
Ccdc110 T G 8: 45,940,609 S119R probably benign Het
Ceacam20 A T 7: 19,970,393 Q123L possibly damaging Het
Clip3 A G 7: 30,298,849 D240G possibly damaging Het
Col24a1 T C 3: 145,298,827 F22S probably benign Het
Dlg5 T A 14: 24,177,792 M354L probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dnase1l3 A G 14: 7,967,847 V282A probably damaging Het
Dnhd1 G A 7: 105,714,821 G4127S probably damaging Het
Eed G A 7: 89,967,793 R165W probably damaging Het
Ephb2 C T 4: 136,661,406 V627M probably damaging Het
Fancc T C 13: 63,317,387 E502G possibly damaging Het
Fbf1 T C 11: 116,157,820 D105G probably damaging Het
Fer T A 17: 64,037,585 Y246* probably null Het
Fer1l6 A G 15: 58,660,825 K1792E probably damaging Het
Foxi2 A G 7: 135,411,647 D202G probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
H2-DMb2 G T 17: 34,145,471 probably null Het
Helq G T 5: 100,787,050 D491E probably benign Het
Hgsnat A G 8: 25,946,334 V564A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st5 T A 10: 36,833,429 V320D probably damaging Het
Ifit1bl1 A T 19: 34,593,797 L420* probably null Het
Ift80 T G 3: 68,967,863 N178T probably benign Het
Ing4 C T 6: 125,047,060 T89I possibly damaging Het
Lcp1 G A 14: 75,212,508 D386N probably benign Het
Mdc1 T A 17: 35,848,546 I606K probably benign Het
Mllt10 T A 2: 18,109,845 M120K probably damaging Het
Morc1 G T 16: 48,449,348 L89F probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nav3 C A 10: 109,716,552 D1810Y probably damaging Het
Obscn G A 11: 59,036,093 T5532M probably damaging Het
Olfr527 C T 7: 140,336,152 Q97* probably null Het
Olfr716 A G 7: 107,148,090 N258S probably benign Het
Opn3 C T 1: 175,665,587 R137H probably damaging Het
Palld G A 8: 61,516,585 A993V probably damaging Het
Ppp1r12c A T 7: 4,486,356 probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Rapgef2 A T 3: 79,088,643 probably null Het
Ring1 T C 17: 34,021,458 E382G possibly damaging Het
Rpl22l1 T A 3: 28,806,820 N61K probably benign Het
Rpp14 A G 14: 8,090,558 probably null Het
Rusc2 C T 4: 43,415,932 Q413* probably null Het
Slco3a1 A G 7: 74,318,499 I491T possibly damaging Het
Smtnl1 C T 2: 84,818,395 V172I probably benign Het
Spats2l T A 1: 57,900,621 probably null Het
Spire1 T A 18: 67,506,646 N266Y probably damaging Het
Syne2 C T 12: 76,094,458 R121* probably null Het
Synrg G A 11: 84,002,240 probably null Het
Tm9sf1 C T 14: 55,638,097 V397M probably damaging Het
Trabd T C 15: 89,081,984 M48T probably benign Het
Ttn T A 2: 76,707,233 I26457F possibly damaging Het
Uggt2 C T 14: 119,041,527 R856Q probably benign Het
Ugt1a5 T A 1: 88,166,317 M89K probably benign Het
Vmn2r53 A T 7: 12,601,420 S104R probably damaging Het
Zdhhc12 A T 2: 30,092,484 L53Q probably null Het
Other mutations in Stox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02234:Stox2 APN 8 47193612 missense probably damaging 1.00
IGL02331:Stox2 APN 8 47191944 missense probably damaging 0.96
IGL02399:Stox2 APN 8 47186538 missense probably damaging 0.99
IGL03091:Stox2 APN 8 47193187 missense possibly damaging 0.66
IGL03143:Stox2 APN 8 47193804 missense possibly damaging 0.78
IGL03307:Stox2 APN 8 47194030 missense probably damaging 1.00
R0082:Stox2 UTSW 8 47203282 splice site probably benign
R0313:Stox2 UTSW 8 47192134 missense probably damaging 1.00
R0382:Stox2 UTSW 8 47203284 splice site probably benign
R0513:Stox2 UTSW 8 47193865 missense probably damaging 1.00
R0539:Stox2 UTSW 8 47194035 missense probably damaging 0.97
R0920:Stox2 UTSW 8 47193018 missense probably damaging 1.00
R1764:Stox2 UTSW 8 47194016 nonsense probably null
R1923:Stox2 UTSW 8 47193626 missense probably damaging 1.00
R2311:Stox2 UTSW 8 47191978 missense probably damaging 1.00
R3196:Stox2 UTSW 8 47192830 missense probably damaging 0.99
R3715:Stox2 UTSW 8 47413152 missense possibly damaging 0.90
R4300:Stox2 UTSW 8 47193992 nonsense probably null
R4534:Stox2 UTSW 8 47193379 missense probably damaging 1.00
R4600:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4601:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4602:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4603:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4610:Stox2 UTSW 8 47192935 missense probably damaging 1.00
R4624:Stox2 UTSW 8 47193816 missense probably damaging 1.00
R4672:Stox2 UTSW 8 47192106 missense probably damaging 1.00
R4888:Stox2 UTSW 8 47203163 missense probably damaging 1.00
R4944:Stox2 UTSW 8 47413265 missense possibly damaging 0.46
R5331:Stox2 UTSW 8 47413627 utr 5 prime probably benign
R5349:Stox2 UTSW 8 47287916 missense possibly damaging 0.70
R5367:Stox2 UTSW 8 47203225 missense probably damaging 1.00
R5471:Stox2 UTSW 8 47193513 missense probably damaging 0.96
R5630:Stox2 UTSW 8 47191890 missense probably damaging 1.00
R5719:Stox2 UTSW 8 47413137 nonsense probably null
R5733:Stox2 UTSW 8 47413137 nonsense probably null
R5996:Stox2 UTSW 8 47203147 missense possibly damaging 0.93
R6170:Stox2 UTSW 8 47192020 missense probably benign 0.02
R6458:Stox2 UTSW 8 47192044 missense possibly damaging 0.66
R6786:Stox2 UTSW 8 47186465 missense probably damaging 1.00
R6815:Stox2 UTSW 8 47193101 missense probably damaging 1.00
R6951:Stox2 UTSW 8 47203132 missense probably damaging 1.00
R7193:Stox2 UTSW 8 47186454 missense probably benign
R7330:Stox2 UTSW 8 47192236 missense possibly damaging 0.61
R7552:Stox2 UTSW 8 47203119 critical splice donor site probably null
R8001:Stox2 UTSW 8 47186477 missense probably benign 0.06
R8266:Stox2 UTSW 8 47192025 missense probably damaging 0.99
R8506:Stox2 UTSW 8 47192073 missense possibly damaging 0.79
R8935:Stox2 UTSW 8 47192860 missense possibly damaging 0.66
R9261:Stox2 UTSW 8 47192406 missense possibly damaging 0.78
R9325:Stox2 UTSW 8 47194060 missense probably benign 0.45
R9505:Stox2 UTSW 8 47192269 missense probably benign 0.28
X0027:Stox2 UTSW 8 47193840 missense possibly damaging 0.95
Z1177:Stox2 UTSW 8 47194050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATGACCAATCGTTTGCG -3'
(R):5'- GGGCTGCTTCATCATTGAACAC -3'

Sequencing Primer
(F):5'- TTGCGCAGGCCTTAAAGTAC -3'
(R):5'- CTGCTTCATCATTGAACACAAAGGG -3'
Posted On 2016-10-24