Incidental Mutation 'R5561:Palld'
ID 436605
Institutional Source Beutler Lab
Gene Symbol Palld
Ensembl Gene ENSMUSG00000058056
Gene Name palladin, cytoskeletal associated protein
Synonyms 2410003B16Rik
MMRRC Submission 043118-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5561 (G1)
Quality Score 224
Status Not validated
Chromosome 8
Chromosomal Location 61964467-62355724 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 61969619 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 993 (A993V)
Ref Sequence ENSEMBL: ENSMUSP00000034057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034057] [ENSMUST00000121200] [ENSMUST00000121493] [ENSMUST00000121785] [ENSMUST00000135439]
AlphaFold Q9ET54
PDB Structure NMR structure of Ig3 domain of palladin [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000034057
AA Change: A993V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034057
Gene: ENSMUSG00000058056
AA Change: A993V

DomainStartEndE-ValueType
IGc2 290 358 1.45e-9 SMART
low complexity region 372 385 N/A INTRINSIC
IGc2 460 535 1.6e-11 SMART
low complexity region 639 667 N/A INTRINSIC
IGc2 796 865 3.1e-9 SMART
low complexity region 881 906 N/A INTRINSIC
IGc2 930 998 4.92e-12 SMART
IGc2 1029 1098 1.61e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121200
AA Change: A490V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112374
Gene: ENSMUSG00000058056
AA Change: A490V

DomainStartEndE-ValueType
low complexity region 37 68 N/A INTRINSIC
low complexity region 77 112 N/A INTRINSIC
IGc2 293 362 3.1e-9 SMART
low complexity region 378 403 N/A INTRINSIC
IGc2 427 495 4.92e-12 SMART
IGc2 526 595 1.61e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000121493
AA Change: A829V
SMART Domains Protein: ENSMUSP00000113874
Gene: ENSMUSG00000058056
AA Change: A829V

DomainStartEndE-ValueType
IGc2 71 146 1.6e-11 SMART
low complexity region 250 284 N/A INTRINSIC
low complexity region 298 326 N/A INTRINSIC
low complexity region 376 407 N/A INTRINSIC
low complexity region 416 451 N/A INTRINSIC
IGc2 632 701 3.1e-9 SMART
low complexity region 717 742 N/A INTRINSIC
IGc2 766 834 4.92e-12 SMART
IGc2 865 934 1.61e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000121785
AA Change: A1235V
SMART Domains Protein: ENSMUSP00000112442
Gene: ENSMUSG00000058056
AA Change: A1235V

DomainStartEndE-ValueType
IGc2 290 358 1.45e-9 SMART
low complexity region 372 385 N/A INTRINSIC
IGc2 460 535 1.6e-11 SMART
low complexity region 639 673 N/A INTRINSIC
low complexity region 687 715 N/A INTRINSIC
low complexity region 765 796 N/A INTRINSIC
low complexity region 805 840 N/A INTRINSIC
IGc2 1038 1107 3.1e-9 SMART
low complexity region 1123 1148 N/A INTRINSIC
IGc2 1172 1240 4.92e-12 SMART
IGc2 1271 1340 1.61e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135439
AA Change: A279V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119792
Gene: ENSMUSG00000058056
AA Change: A279V

DomainStartEndE-ValueType
IGc2 82 151 3.1e-9 SMART
low complexity region 167 192 N/A INTRINSIC
IGc2 216 284 4.92e-12 SMART
internal_repeat_1 302 336 1.47e-9 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153495
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is required for organizing the actin cytoskeleton. The protein is a component of actin-containing microfilaments, and it is involved in the control of cell shape, adhesion, and contraction. Polymorphisms in this gene are associated with a susceptibility to pancreatic cancer type 1, and also with a risk for myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: All homozygous null embryos die around E15.5 displaying exencephaly derived from neural tube closure defects, and herniation of the intestine and liver due to ventral closure defects. Mutant MEFs show impaired formation of actin stress fibers, reduced migration and decreased adhesion to fibronectin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik T C 1: 75,197,181 (GRCm39) probably benign Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adgrv1 A G 13: 81,624,683 (GRCm39) L3762P probably damaging Het
Amn1 G A 6: 149,086,522 (GRCm39) R4W probably damaging Het
Atxn1 G T 13: 45,720,347 (GRCm39) T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 (GRCm38) T259S probably benign Het
Bsn C G 9: 107,982,710 (GRCm39) R3681P unknown Het
C8b T C 4: 104,641,645 (GRCm39) Y194H possibly damaging Het
Ccdc110 T G 8: 46,393,646 (GRCm39) S119R probably benign Het
Ccdc202 C A 14: 96,119,807 (GRCm39) A188E probably benign Het
Ceacam20 A T 7: 19,704,318 (GRCm39) Q123L possibly damaging Het
Clip3 A G 7: 29,998,274 (GRCm39) D240G possibly damaging Het
Col24a1 T C 3: 145,004,588 (GRCm39) F22S probably benign Het
Dlg5 T A 14: 24,227,860 (GRCm39) M354L probably benign Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Dnase1l3 A G 14: 7,967,847 (GRCm38) V282A probably damaging Het
Dnhd1 G A 7: 105,364,028 (GRCm39) G4127S probably damaging Het
Eed G A 7: 89,617,001 (GRCm39) R165W probably damaging Het
Ephb2 C T 4: 136,388,717 (GRCm39) V627M probably damaging Het
Fancc T C 13: 63,465,201 (GRCm39) E502G possibly damaging Het
Fbf1 T C 11: 116,048,646 (GRCm39) D105G probably damaging Het
Fer T A 17: 64,344,580 (GRCm39) Y246* probably null Het
Fer1l6 A G 15: 58,532,674 (GRCm39) K1792E probably damaging Het
Foxi2 A G 7: 135,013,376 (GRCm39) D202G probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
H2-DMb2 G T 17: 34,364,445 (GRCm39) probably null Het
Helq G T 5: 100,934,916 (GRCm39) D491E probably benign Het
Hgsnat A G 8: 26,436,362 (GRCm39) V564A possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hs3st5 T A 10: 36,709,425 (GRCm39) V320D probably damaging Het
Ifit1bl1 A T 19: 34,571,197 (GRCm39) L420* probably null Het
Ift80 T G 3: 68,875,196 (GRCm39) N178T probably benign Het
Ing4 C T 6: 125,024,023 (GRCm39) T89I possibly damaging Het
Lcp1 G A 14: 75,449,948 (GRCm39) D386N probably benign Het
Mdc1 T A 17: 36,159,438 (GRCm39) I606K probably benign Het
Mllt10 T A 2: 18,114,656 (GRCm39) M120K probably damaging Het
Morc1 G T 16: 48,269,711 (GRCm39) L89F probably benign Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Nav3 C A 10: 109,552,413 (GRCm39) D1810Y probably damaging Het
Obscn G A 11: 58,926,919 (GRCm39) T5532M probably damaging Het
Opn3 C T 1: 175,493,153 (GRCm39) R137H probably damaging Het
Or12j2 C T 7: 139,916,065 (GRCm39) Q97* probably null Het
Or2d36 A G 7: 106,747,297 (GRCm39) N258S probably benign Het
Ppp1r12c A T 7: 4,489,355 (GRCm39) probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,728,987 (GRCm39) probably null Het
Rapgef2 A T 3: 78,995,950 (GRCm39) probably null Het
Ring1 T C 17: 34,240,432 (GRCm39) E382G possibly damaging Het
Rpl22l1 T A 3: 28,860,969 (GRCm39) N61K probably benign Het
Rpp14 A G 14: 8,090,558 (GRCm38) probably null Het
Rusc2 C T 4: 43,415,932 (GRCm39) Q413* probably null Het
Slco3a1 A G 7: 73,968,247 (GRCm39) I491T possibly damaging Het
Smtnl1 C T 2: 84,648,739 (GRCm39) V172I probably benign Het
Spats2l T A 1: 57,939,780 (GRCm39) probably null Het
Spire1 T A 18: 67,639,716 (GRCm39) N266Y probably damaging Het
Stox2 T C 8: 47,646,041 (GRCm39) H473R probably damaging Het
Syne2 C T 12: 76,141,232 (GRCm39) R121* probably null Het
Synrg G A 11: 83,893,066 (GRCm39) probably null Het
Tm9sf1 C T 14: 55,875,554 (GRCm39) V397M probably damaging Het
Trabd T C 15: 88,966,187 (GRCm39) M48T probably benign Het
Ttn T A 2: 76,537,577 (GRCm39) I26457F possibly damaging Het
Uggt2 C T 14: 119,278,939 (GRCm39) R856Q probably benign Het
Ugt1a5 T A 1: 88,094,039 (GRCm39) M89K probably benign Het
Vmn2r53 A T 7: 12,335,347 (GRCm39) S104R probably damaging Het
Zdhhc12 A T 2: 29,982,496 (GRCm39) L53Q probably null Het
Other mutations in Palld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Palld APN 8 61,968,969 (GRCm39) missense possibly damaging 0.77
IGL01083:Palld APN 8 61,991,841 (GRCm39) missense probably benign 0.44
IGL01644:Palld APN 8 62,330,512 (GRCm39) missense probably benign 0.28
IGL01672:Palld APN 8 62,330,536 (GRCm39) missense probably benign 0.22
IGL01941:Palld APN 8 61,988,734 (GRCm39) missense probably benign 0.44
IGL02037:Palld APN 8 61,978,148 (GRCm39) missense probably damaging 1.00
IGL02126:Palld APN 8 62,330,476 (GRCm39) missense possibly damaging 0.82
IGL02537:Palld APN 8 62,137,968 (GRCm39) missense probably benign 0.05
IGL02632:Palld APN 8 61,968,279 (GRCm39) missense probably damaging 1.00
IGL02809:Palld APN 8 61,968,281 (GRCm39) missense probably damaging 1.00
IGL02901:Palld APN 8 62,330,029 (GRCm39) nonsense probably null
IGL03400:Palld APN 8 61,966,489 (GRCm39) missense probably damaging 1.00
R0098:Palld UTSW 8 61,978,120 (GRCm39) missense probably damaging 1.00
R0098:Palld UTSW 8 61,978,120 (GRCm39) missense probably damaging 1.00
R0745:Palld UTSW 8 62,330,737 (GRCm39) missense probably damaging 1.00
R1263:Palld UTSW 8 61,966,491 (GRCm39) frame shift probably null
R1342:Palld UTSW 8 61,975,916 (GRCm39) critical splice donor site probably null
R1893:Palld UTSW 8 61,969,655 (GRCm39) missense probably damaging 1.00
R2017:Palld UTSW 8 62,137,799 (GRCm39) missense probably damaging 0.99
R2102:Palld UTSW 8 61,986,467 (GRCm39) missense possibly damaging 0.82
R2129:Palld UTSW 8 62,330,395 (GRCm39) missense probably benign 0.00
R2246:Palld UTSW 8 62,330,169 (GRCm39) missense probably benign 0.01
R3545:Palld UTSW 8 62,003,112 (GRCm39) missense possibly damaging 0.95
R3815:Palld UTSW 8 62,002,871 (GRCm39) intron probably benign
R3824:Palld UTSW 8 62,162,067 (GRCm39) missense probably damaging 1.00
R4412:Palld UTSW 8 62,140,406 (GRCm39) missense probably damaging 0.98
R4781:Palld UTSW 8 62,330,062 (GRCm39) missense probably benign 0.01
R4836:Palld UTSW 8 62,140,415 (GRCm39) missense probably benign 0.11
R4871:Palld UTSW 8 62,002,815 (GRCm39) intron probably benign
R4963:Palld UTSW 8 62,156,244 (GRCm39) missense probably damaging 1.00
R5036:Palld UTSW 8 62,003,196 (GRCm39) missense probably damaging 1.00
R5128:Palld UTSW 8 62,173,622 (GRCm39) missense probably damaging 1.00
R5343:Palld UTSW 8 62,002,849 (GRCm39) intron probably benign
R5421:Palld UTSW 8 61,969,584 (GRCm39) missense probably damaging 1.00
R5427:Palld UTSW 8 62,003,106 (GRCm39) missense probably benign 0.01
R5651:Palld UTSW 8 61,991,822 (GRCm39) missense probably damaging 1.00
R5679:Palld UTSW 8 62,137,979 (GRCm39) missense possibly damaging 0.95
R5915:Palld UTSW 8 61,986,386 (GRCm39) critical splice donor site probably null
R6153:Palld UTSW 8 62,003,186 (GRCm39) missense probably damaging 1.00
R6276:Palld UTSW 8 61,966,457 (GRCm39) missense probably damaging 1.00
R6323:Palld UTSW 8 62,173,727 (GRCm39) missense probably damaging 1.00
R6659:Palld UTSW 8 61,986,477 (GRCm39) missense probably benign 0.28
R7016:Palld UTSW 8 61,969,032 (GRCm39) missense probably damaging 1.00
R7124:Palld UTSW 8 61,969,679 (GRCm39) missense unknown
R7145:Palld UTSW 8 61,985,051 (GRCm39) missense unknown
R7386:Palld UTSW 8 61,985,086 (GRCm39) missense unknown
R7407:Palld UTSW 8 61,968,975 (GRCm39) nonsense probably null
R7723:Palld UTSW 8 62,164,492 (GRCm39) missense probably damaging 1.00
R8029:Palld UTSW 8 62,330,346 (GRCm39) missense probably damaging 1.00
R8402:Palld UTSW 8 62,164,440 (GRCm39) missense probably damaging 1.00
R8775:Palld UTSW 8 62,138,006 (GRCm39) missense possibly damaging 0.73
R8775-TAIL:Palld UTSW 8 62,138,006 (GRCm39) missense possibly damaging 0.73
R8887:Palld UTSW 8 61,986,512 (GRCm39) missense unknown
R8906:Palld UTSW 8 62,003,198 (GRCm39) critical splice donor site probably null
R8969:Palld UTSW 8 62,137,883 (GRCm39) missense probably damaging 1.00
R8971:Palld UTSW 8 61,969,735 (GRCm39) missense unknown
R8990:Palld UTSW 8 61,968,279 (GRCm39) missense probably damaging 1.00
R9012:Palld UTSW 8 62,173,697 (GRCm39) missense possibly damaging 0.85
R9145:Palld UTSW 8 62,330,107 (GRCm39) missense probably benign 0.01
R9221:Palld UTSW 8 61,969,591 (GRCm39) missense unknown
R9228:Palld UTSW 8 62,173,571 (GRCm39) missense probably damaging 1.00
R9311:Palld UTSW 8 61,978,189 (GRCm39) missense unknown
R9355:Palld UTSW 8 61,969,691 (GRCm39) missense unknown
R9376:Palld UTSW 8 61,969,691 (GRCm39) missense unknown
R9377:Palld UTSW 8 61,969,691 (GRCm39) missense unknown
R9378:Palld UTSW 8 61,969,691 (GRCm39) missense unknown
R9467:Palld UTSW 8 61,968,264 (GRCm39) missense unknown
R9638:Palld UTSW 8 62,002,788 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGGTGCCGAGTATTTCAGCAC -3'
(R):5'- GGAGAAGTTCATGTGTGTCTCC -3'

Sequencing Primer
(F):5'- CGAGTATTTCAGCACCAGGATTC -3'
(R):5'- AGAAGTTCATGTGTGTCTCCTTTCTG -3'
Posted On 2016-10-24