Incidental Mutation 'R5561:Hs3st5'
ID436608
Institutional Source Beutler Lab
Gene Symbol Hs3st5
Ensembl Gene ENSMUSG00000044499
Gene Nameheparan sulfate (glucosamine) 3-O-sulfotransferase 5
SynonymsLOC382362, D930005L05Rik
MMRRC Submission 043118-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5561 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location36506814-36834397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36833429 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 320 (V320D)
Ref Sequence ENSEMBL: ENSMUSP00000129434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058738] [ENSMUST00000167191] [ENSMUST00000168572]
Predicted Effect probably damaging
Transcript: ENSMUST00000058738
AA Change: V320D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060229
Gene: ENSMUSG00000044499
AA Change: V320D

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Sulfotransfer_1 90 339 5.5e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167191
AA Change: V320D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130778
Gene: ENSMUSG00000044499
AA Change: V320D

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Sulfotransfer_1 90 339 5.5e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168572
AA Change: V320D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129434
Gene: ENSMUSG00000044499
AA Change: V320D

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Sulfotransfer_1 90 339 5.5e-38 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HS3ST5 belongs to a group of heparan sulfate 3-O-sulfotransferases (EC 2.8.2.23) that transfer sulfate from 3-prime-phosphoadenosine 5-prime phosphosulfate (PAPS) to heparan sulfate and heparin (Mochizuki et al., 2003 [PubMed 12740361]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik C A 14: 95,882,371 A188E probably benign Het
A630095N17Rik T C 1: 75,220,537 probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrv1 A G 13: 81,476,564 L3762P probably damaging Het
Amn1 G A 6: 149,185,024 R4W probably damaging Het
Atxn1 G T 13: 45,566,871 T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 T259S probably benign Het
Bsn C G 9: 108,105,511 R3681P unknown Het
C8b T C 4: 104,784,448 Y194H possibly damaging Het
Ccdc110 T G 8: 45,940,609 S119R probably benign Het
Ceacam20 A T 7: 19,970,393 Q123L possibly damaging Het
Clip3 A G 7: 30,298,849 D240G possibly damaging Het
Col24a1 T C 3: 145,298,827 F22S probably benign Het
Dlg5 T A 14: 24,177,792 M354L probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dnase1l3 A G 14: 7,967,847 V282A probably damaging Het
Dnhd1 G A 7: 105,714,821 G4127S probably damaging Het
Eed G A 7: 89,967,793 R165W probably damaging Het
Ephb2 C T 4: 136,661,406 V627M probably damaging Het
Fancc T C 13: 63,317,387 E502G possibly damaging Het
Fbf1 T C 11: 116,157,820 D105G probably damaging Het
Fer T A 17: 64,037,585 Y246* probably null Het
Fer1l6 A G 15: 58,660,825 K1792E probably damaging Het
Foxi2 A G 7: 135,411,647 D202G probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
H2-DMb2 G T 17: 34,145,471 probably null Het
Helq G T 5: 100,787,050 D491E probably benign Het
Hgsnat A G 8: 25,946,334 V564A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ifit1bl1 A T 19: 34,593,797 L420* probably null Het
Ift80 T G 3: 68,967,863 N178T probably benign Het
Ing4 C T 6: 125,047,060 T89I possibly damaging Het
Lcp1 G A 14: 75,212,508 D386N probably benign Het
Mdc1 T A 17: 35,848,546 I606K probably benign Het
Mllt10 T A 2: 18,109,845 M120K probably damaging Het
Morc1 G T 16: 48,449,348 L89F probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nav3 C A 10: 109,716,552 D1810Y probably damaging Het
Obscn G A 11: 59,036,093 T5532M probably damaging Het
Olfr527 C T 7: 140,336,152 Q97* probably null Het
Olfr716 A G 7: 107,148,090 N258S probably benign Het
Opn3 C T 1: 175,665,587 R137H probably damaging Het
Palld G A 8: 61,516,585 A993V probably damaging Het
Ppp1r12c A T 7: 4,486,356 probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Rapgef2 A T 3: 79,088,643 probably null Het
Ring1 T C 17: 34,021,458 E382G possibly damaging Het
Rpl22l1 T A 3: 28,806,820 N61K probably benign Het
Rpp14 A G 14: 8,090,558 probably null Het
Rusc2 C T 4: 43,415,932 Q413* probably null Het
Slco3a1 A G 7: 74,318,499 I491T possibly damaging Het
Smtnl1 C T 2: 84,818,395 V172I probably benign Het
Spats2l T A 1: 57,900,621 probably null Het
Spire1 T A 18: 67,506,646 N266Y probably damaging Het
Stox2 T C 8: 47,193,006 H473R probably damaging Het
Syne2 C T 12: 76,094,458 R121* probably null Het
Synrg G A 11: 84,002,240 probably null Het
Tm9sf1 C T 14: 55,638,097 V397M probably damaging Het
Trabd T C 15: 89,081,984 M48T probably benign Het
Ttn T A 2: 76,707,233 I26457F possibly damaging Het
Uggt2 C T 14: 119,041,527 R856Q probably benign Het
Ugt1a5 T A 1: 88,166,317 M89K probably benign Het
Vmn2r53 A T 7: 12,601,420 S104R probably damaging Het
Zdhhc12 A T 2: 30,092,484 L53Q probably null Het
Other mutations in Hs3st5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Hs3st5 APN 10 36832922 missense probably benign 0.02
IGL00913:Hs3st5 APN 10 36832850 missense probably damaging 1.00
IGL01407:Hs3st5 APN 10 36833408 missense probably damaging 1.00
IGL01516:Hs3st5 APN 10 36833051 missense probably damaging 1.00
IGL02396:Hs3st5 APN 10 36828703 start codon destroyed probably benign 0.08
IGL03351:Hs3st5 APN 10 36833323 missense probably damaging 1.00
R0606:Hs3st5 UTSW 10 36832588 missense probably benign 0.00
R1412:Hs3st5 UTSW 10 36832676 missense probably benign 0.02
R1443:Hs3st5 UTSW 10 36833414 missense probably benign 0.35
R1493:Hs3st5 UTSW 10 36832874 missense probably damaging 1.00
R1768:Hs3st5 UTSW 10 36833169 missense probably benign 0.01
R1792:Hs3st5 UTSW 10 36832724 missense probably benign
R1991:Hs3st5 UTSW 10 36832886 missense probably damaging 1.00
R1992:Hs3st5 UTSW 10 36832886 missense probably damaging 1.00
R4330:Hs3st5 UTSW 10 36832730 missense probably benign 0.06
R4610:Hs3st5 UTSW 10 36828806 missense probably benign 0.26
R5459:Hs3st5 UTSW 10 36828746 missense possibly damaging 0.85
R6005:Hs3st5 UTSW 10 36832928 missense probably damaging 1.00
R7082:Hs3st5 UTSW 10 36832837 missense probably benign 0.01
R7326:Hs3st5 UTSW 10 36833194 missense probably damaging 1.00
R7507:Hs3st5 UTSW 10 36833015 missense probably damaging 1.00
R7885:Hs3st5 UTSW 10 36828780 nonsense probably null
R7968:Hs3st5 UTSW 10 36828780 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACCTCTGCCGGAACTACAG -3'
(R):5'- ATTTGGTCACACACTGCATATG -3'

Sequencing Primer
(F):5'- CAGCTGGTGGAAAAGTTCTTAAACC -3'
(R):5'- TGGTCACACACTGCATATGTACAAG -3'
Posted On2016-10-24