Incidental Mutation 'R5561:Dnajb12'
ID 436609
Institutional Source Beutler Lab
Gene Symbol Dnajb12
Ensembl Gene ENSMUSG00000020109
Gene Name DnaJ heat shock protein family (Hsp40) member B12
Synonyms mDj10
MMRRC Submission 043118-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R5561 (G1)
Quality Score 211
Status Not validated
Chromosome 10
Chromosomal Location 59879556-59899302 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) GC to G at 59892752 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020309] [ENSMUST00000131810] [ENSMUST00000142819] [ENSMUST00000146590] [ENSMUST00000147914]
AlphaFold Q9QYI4
Predicted Effect probably null
Transcript: ENSMUST00000020309
SMART Domains Protein: ENSMUSP00000020309
Gene: ENSMUSG00000020109

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 262 370 2.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131810
SMART Domains Protein: ENSMUSP00000116244
Gene: ENSMUSG00000020109

DomainStartEndE-ValueType
SCOP:d1a17__ 2 40 4e-3 SMART
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000142819
SMART Domains Protein: ENSMUSP00000118088
Gene: ENSMUSG00000020109

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 262 370 2.8e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146590
SMART Domains Protein: ENSMUSP00000122056
Gene: ENSMUSG00000020109

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 262 370 2.8e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147914
SMART Domains Protein: ENSMUSP00000116577
Gene: ENSMUSG00000020109

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 263 369 9.2e-31 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNAJB12 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik C A 14: 95,882,371 A188E probably benign Het
A630095N17Rik T C 1: 75,220,537 probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrv1 A G 13: 81,476,564 L3762P probably damaging Het
Amn1 G A 6: 149,185,024 R4W probably damaging Het
Atxn1 G T 13: 45,566,871 T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 T259S probably benign Het
Bsn C G 9: 108,105,511 R3681P unknown Het
C8b T C 4: 104,784,448 Y194H possibly damaging Het
Ccdc110 T G 8: 45,940,609 S119R probably benign Het
Ceacam20 A T 7: 19,970,393 Q123L possibly damaging Het
Clip3 A G 7: 30,298,849 D240G possibly damaging Het
Col24a1 T C 3: 145,298,827 F22S probably benign Het
Dlg5 T A 14: 24,177,792 M354L probably benign Het
Dnase1l3 A G 14: 7,967,847 V282A probably damaging Het
Dnhd1 G A 7: 105,714,821 G4127S probably damaging Het
Eed G A 7: 89,967,793 R165W probably damaging Het
Ephb2 C T 4: 136,661,406 V627M probably damaging Het
Fancc T C 13: 63,317,387 E502G possibly damaging Het
Fbf1 T C 11: 116,157,820 D105G probably damaging Het
Fer T A 17: 64,037,585 Y246* probably null Het
Fer1l6 A G 15: 58,660,825 K1792E probably damaging Het
Foxi2 A G 7: 135,411,647 D202G probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
H2-DMb2 G T 17: 34,145,471 probably null Het
Helq G T 5: 100,787,050 D491E probably benign Het
Hgsnat A G 8: 25,946,334 V564A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st5 T A 10: 36,833,429 V320D probably damaging Het
Ifit1bl1 A T 19: 34,593,797 L420* probably null Het
Ift80 T G 3: 68,967,863 N178T probably benign Het
Ing4 C T 6: 125,047,060 T89I possibly damaging Het
Lcp1 G A 14: 75,212,508 D386N probably benign Het
Mdc1 T A 17: 35,848,546 I606K probably benign Het
Mllt10 T A 2: 18,109,845 M120K probably damaging Het
Morc1 G T 16: 48,449,348 L89F probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nav3 C A 10: 109,716,552 D1810Y probably damaging Het
Obscn G A 11: 59,036,093 T5532M probably damaging Het
Olfr527 C T 7: 140,336,152 Q97* probably null Het
Olfr716 A G 7: 107,148,090 N258S probably benign Het
Opn3 C T 1: 175,665,587 R137H probably damaging Het
Palld G A 8: 61,516,585 A993V probably damaging Het
Ppp1r12c A T 7: 4,486,356 probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Rapgef2 A T 3: 79,088,643 probably null Het
Ring1 T C 17: 34,021,458 E382G possibly damaging Het
Rpl22l1 T A 3: 28,806,820 N61K probably benign Het
Rpp14 A G 14: 8,090,558 probably null Het
Rusc2 C T 4: 43,415,932 Q413* probably null Het
Slco3a1 A G 7: 74,318,499 I491T possibly damaging Het
Smtnl1 C T 2: 84,818,395 V172I probably benign Het
Spats2l T A 1: 57,900,621 probably null Het
Spire1 T A 18: 67,506,646 N266Y probably damaging Het
Stox2 T C 8: 47,193,006 H473R probably damaging Het
Syne2 C T 12: 76,094,458 R121* probably null Het
Synrg G A 11: 84,002,240 probably null Het
Tm9sf1 C T 14: 55,638,097 V397M probably damaging Het
Trabd T C 15: 89,081,984 M48T probably benign Het
Ttn T A 2: 76,707,233 I26457F possibly damaging Het
Uggt2 C T 14: 119,041,527 R856Q probably benign Het
Ugt1a5 T A 1: 88,166,317 M89K probably benign Het
Vmn2r53 A T 7: 12,601,420 S104R probably damaging Het
Zdhhc12 A T 2: 30,092,484 L53Q probably null Het
Other mutations in Dnajb12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02616:Dnajb12 APN 10 59892863 splice site probably null
IGL03412:Dnajb12 APN 10 59890073 missense probably benign 0.44
PIT4382001:Dnajb12 UTSW 10 59892686 missense probably damaging 1.00
R0496:Dnajb12 UTSW 10 59879801 nonsense probably null
R1692:Dnajb12 UTSW 10 59896377 missense probably damaging 1.00
R2087:Dnajb12 UTSW 10 59890845 missense possibly damaging 0.82
R2276:Dnajb12 UTSW 10 59892977 missense probably benign 0.31
R4110:Dnajb12 UTSW 10 59894314 missense possibly damaging 0.78
R4113:Dnajb12 UTSW 10 59894314 missense possibly damaging 0.78
R4365:Dnajb12 UTSW 10 59879766 missense probably damaging 1.00
R4382:Dnajb12 UTSW 10 59897499 missense probably benign
R4757:Dnajb12 UTSW 10 59892770 missense probably benign
R5156:Dnajb12 UTSW 10 59892960 missense probably damaging 1.00
R5455:Dnajb12 UTSW 10 59892752 frame shift probably null
R5484:Dnajb12 UTSW 10 59892752 frame shift probably null
R5486:Dnajb12 UTSW 10 59892752 frame shift probably null
R5487:Dnajb12 UTSW 10 59892752 frame shift probably null
R5504:Dnajb12 UTSW 10 59892752 frame shift probably null
R5506:Dnajb12 UTSW 10 59892752 frame shift probably null
R5507:Dnajb12 UTSW 10 59892752 frame shift probably null
R5560:Dnajb12 UTSW 10 59892752 frame shift probably null
R5601:Dnajb12 UTSW 10 59892752 frame shift probably null
R5603:Dnajb12 UTSW 10 59892752 frame shift probably null
R5604:Dnajb12 UTSW 10 59892752 frame shift probably null
R6013:Dnajb12 UTSW 10 59894341 critical splice donor site probably null
R6724:Dnajb12 UTSW 10 59892780 missense possibly damaging 0.92
R6935:Dnajb12 UTSW 10 59896503 critical splice donor site probably null
R8044:Dnajb12 UTSW 10 59896350 missense possibly damaging 0.88
R8073:Dnajb12 UTSW 10 59890179 nonsense probably null
R9235:Dnajb12 UTSW 10 59892977 missense probably benign 0.31
X0022:Dnajb12 UTSW 10 59892976 missense probably null 0.00
Z1088:Dnajb12 UTSW 10 59890054 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TTTAGCCTTGCCTAGAGGTGC -3'
(R):5'- GAACGTTACCTGAAACATGGAG -3'

Sequencing Primer
(F):5'- TCTGGATTGCCTGCCCAACAG -3'
(R):5'- TTACCTGAAACATGGAGATAGAGTC -3'
Posted On 2016-10-24