Incidental Mutation 'R0006:Aldh3a1'
ID43661
Institutional Source Beutler Lab
Gene Symbol Aldh3a1
Ensembl Gene ENSMUSG00000019102
Gene Namealdehyde dehydrogenase family 3, subfamily A1
SynonymsAhd4, Ahd-4, Aldh3, Aldh
MMRRC Submission 041980-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0006 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61207537-61218421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61217101 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 324 (V324M)
Ref Sequence ENSEMBL: ENSMUSP00000104356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019246] [ENSMUST00000108716] [ENSMUST00000147792]
Predicted Effect probably damaging
Transcript: ENSMUST00000019246
AA Change: V324M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019246
Gene: ENSMUSG00000019102
AA Change: V324M

DomainStartEndE-ValueType
Pfam:Aldedh 1 428 3.6e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108716
AA Change: V324M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104356
Gene: ENSMUSG00000019102
AA Change: V324M

DomainStartEndE-ValueType
Pfam:Aldedh 1 428 4.1e-98 PFAM
Pfam:LuxC 4 389 9.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147792
Meta Mutation Damage Score 0.3456 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde dehydrogenases oxidize various aldehydes to the corresponding acids. They are involved in the detoxification of alcohol-derived acetaldehyde and in the metabolism of corticosteroids, biogenic amines, neurotransmitters, and lipid peroxidation. The enzyme encoded by this gene forms a cytoplasmic homodimer that preferentially oxidizes aromatic and medium-chain (6 carbons or more) saturated and unsaturated aldehyde substrates. It is thought to promote resistance to UV and 4-hydroxy-2-nonenal-induced oxidative damage in the cornea. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygous mutation of this gene does not result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Cfap61 G A 2: 146,077,312 V655I probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Aldh3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Aldh3a1 APN 11 61213596 missense probably damaging 1.00
IGL00833:Aldh3a1 APN 11 61217180 missense probably damaging 0.99
IGL02281:Aldh3a1 APN 11 61217123 unclassified probably null
IGL02608:Aldh3a1 APN 11 61216321 missense probably damaging 1.00
IGL03294:Aldh3a1 APN 11 61214722 missense probably damaging 1.00
R0453:Aldh3a1 UTSW 11 61215512 missense probably benign 0.01
R0612:Aldh3a1 UTSW 11 61214619 missense probably damaging 1.00
R0637:Aldh3a1 UTSW 11 61215478 unclassified probably benign
R1613:Aldh3a1 UTSW 11 61214551 missense probably damaging 0.98
R3423:Aldh3a1 UTSW 11 61215536 missense probably damaging 1.00
R3772:Aldh3a1 UTSW 11 61214605 missense possibly damaging 0.86
R4673:Aldh3a1 UTSW 11 61213494 missense probably benign
R4997:Aldh3a1 UTSW 11 61212311 missense probably benign 0.02
R5425:Aldh3a1 UTSW 11 61213581 missense probably benign 0.01
R5514:Aldh3a1 UTSW 11 61218041 missense probably damaging 1.00
R5679:Aldh3a1 UTSW 11 61217168 missense probably benign 0.00
R6150:Aldh3a1 UTSW 11 61213508 missense probably benign
R6662:Aldh3a1 UTSW 11 61214655 missense probably benign 0.01
R6986:Aldh3a1 UTSW 11 61214251 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCCAGTTAACAAGGAGACAGGAG -3'
(R):5'- TGTAAGTGCTGTGCCTGATGAGCC -3'

Sequencing Primer
(F):5'- ATCTGCCAGGATGTAGTCTAAGC -3'
(R):5'- TGCCTGATGAGCCAGGAATC -3'
Posted On2013-05-29