Incidental Mutation 'R5561:Synrg'
ID436613
Institutional Source Beutler Lab
Gene Symbol Synrg
Ensembl Gene ENSMUSG00000034940
Gene Namesynergin, gamma
SynonymsAp1gbp1, L71-5
MMRRC Submission 043118-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5561 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location83964428-84044578 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 84002240 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049714] [ENSMUST00000092834] [ENSMUST00000183456] [ENSMUST00000183714]
Predicted Effect probably null
Transcript: ENSMUST00000049714
SMART Domains Protein: ENSMUSP00000059000
Gene: ENSMUSG00000034940

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
coiled coil region 113 153 N/A INTRINSIC
Blast:EH 301 368 8e-6 BLAST
low complexity region 560 569 N/A INTRINSIC
low complexity region 644 662 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1295 1306 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000092834
SMART Domains Protein: ENSMUSP00000090510
Gene: ENSMUSG00000034940

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
Blast:EH 222 289 5e-6 BLAST
low complexity region 481 490 N/A INTRINSIC
low complexity region 565 583 N/A INTRINSIC
internal_repeat_1 617 755 7.57e-6 PROSPERO
internal_repeat_1 746 879 7.57e-6 PROSPERO
low complexity region 880 894 N/A INTRINSIC
low complexity region 1127 1138 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183456
SMART Domains Protein: ENSMUSP00000138969
Gene: ENSMUSG00000034940

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
low complexity region 197 209 N/A INTRINSIC
Blast:EH 401 468 7e-6 BLAST
low complexity region 660 669 N/A INTRINSIC
low complexity region 744 762 N/A INTRINSIC
internal_repeat_1 796 934 2.26e-5 PROSPERO
internal_repeat_1 925 1058 2.26e-5 PROSPERO
low complexity region 1059 1073 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183714
SMART Domains Protein: ENSMUSP00000139103
Gene: ENSMUSG00000034940

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
coiled coil region 112 152 N/A INTRINSIC
Blast:EH 300 367 6e-6 BLAST
low complexity region 559 568 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
internal_repeat_1 695 833 1.34e-5 PROSPERO
internal_repeat_1 824 957 1.34e-5 PROSPERO
low complexity region 958 972 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the gamma subunit of AP1 clathrin-adaptor complex. The AP1 complex is located at the trans-Golgi network and associates specific proteins with clathrin-coated vesicles. This encoded protein may act to connect the AP1 complex to other proteins. Alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik C A 14: 95,882,371 A188E probably benign Het
A630095N17Rik T C 1: 75,220,537 probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrv1 A G 13: 81,476,564 L3762P probably damaging Het
Amn1 G A 6: 149,185,024 R4W probably damaging Het
Atxn1 G T 13: 45,566,871 T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 T259S probably benign Het
Bsn C G 9: 108,105,511 R3681P unknown Het
C8b T C 4: 104,784,448 Y194H possibly damaging Het
Ccdc110 T G 8: 45,940,609 S119R probably benign Het
Ceacam20 A T 7: 19,970,393 Q123L possibly damaging Het
Clip3 A G 7: 30,298,849 D240G possibly damaging Het
Col24a1 T C 3: 145,298,827 F22S probably benign Het
Dlg5 T A 14: 24,177,792 M354L probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dnase1l3 A G 14: 7,967,847 V282A probably damaging Het
Dnhd1 G A 7: 105,714,821 G4127S probably damaging Het
Eed G A 7: 89,967,793 R165W probably damaging Het
Ephb2 C T 4: 136,661,406 V627M probably damaging Het
Fancc T C 13: 63,317,387 E502G possibly damaging Het
Fbf1 T C 11: 116,157,820 D105G probably damaging Het
Fer T A 17: 64,037,585 Y246* probably null Het
Fer1l6 A G 15: 58,660,825 K1792E probably damaging Het
Foxi2 A G 7: 135,411,647 D202G probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
H2-DMb2 G T 17: 34,145,471 probably null Het
Helq G T 5: 100,787,050 D491E probably benign Het
Hgsnat A G 8: 25,946,334 V564A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st5 T A 10: 36,833,429 V320D probably damaging Het
Ifit1bl1 A T 19: 34,593,797 L420* probably null Het
Ift80 T G 3: 68,967,863 N178T probably benign Het
Ing4 C T 6: 125,047,060 T89I possibly damaging Het
Lcp1 G A 14: 75,212,508 D386N probably benign Het
Mdc1 T A 17: 35,848,546 I606K probably benign Het
Mllt10 T A 2: 18,109,845 M120K probably damaging Het
Morc1 G T 16: 48,449,348 L89F probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nav3 C A 10: 109,716,552 D1810Y probably damaging Het
Obscn G A 11: 59,036,093 T5532M probably damaging Het
Olfr527 C T 7: 140,336,152 Q97* probably null Het
Olfr716 A G 7: 107,148,090 N258S probably benign Het
Opn3 C T 1: 175,665,587 R137H probably damaging Het
Palld G A 8: 61,516,585 A993V probably damaging Het
Ppp1r12c A T 7: 4,486,356 probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Rapgef2 A T 3: 79,088,643 probably null Het
Ring1 T C 17: 34,021,458 E382G possibly damaging Het
Rpl22l1 T A 3: 28,806,820 N61K probably benign Het
Rpp14 A G 14: 8,090,558 probably null Het
Rusc2 C T 4: 43,415,932 Q413* probably null Het
Slco3a1 A G 7: 74,318,499 I491T possibly damaging Het
Smtnl1 C T 2: 84,818,395 V172I probably benign Het
Spats2l T A 1: 57,900,621 probably null Het
Spire1 T A 18: 67,506,646 N266Y probably damaging Het
Stox2 T C 8: 47,193,006 H473R probably damaging Het
Syne2 C T 12: 76,094,458 R121* probably null Het
Tm9sf1 C T 14: 55,638,097 V397M probably damaging Het
Trabd T C 15: 89,081,984 M48T probably benign Het
Ttn T A 2: 76,707,233 I26457F possibly damaging Het
Uggt2 C T 14: 119,041,527 R856Q probably benign Het
Ugt1a5 T A 1: 88,166,317 M89K probably benign Het
Vmn2r53 A T 7: 12,601,420 S104R probably damaging Het
Zdhhc12 A T 2: 30,092,484 L53Q probably null Het
Other mutations in Synrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Synrg APN 11 84039246 missense probably damaging 0.98
IGL01640:Synrg APN 11 83981508 missense probably damaging 1.00
IGL01936:Synrg APN 11 84019705 missense probably benign 0.00
IGL02311:Synrg APN 11 84019804 missense probably benign 0.01
IGL02836:Synrg APN 11 84001978 splice site probably benign
IGL02868:Synrg APN 11 83987050 splice site probably benign
IGL03185:Synrg APN 11 83981479 missense probably damaging 1.00
IGL03224:Synrg APN 11 84039666 missense possibly damaging 0.86
polaris UTSW 11 84019914 missense probably damaging 1.00
P0041:Synrg UTSW 11 83982311 splice site probably benign
R0023:Synrg UTSW 11 84008653 missense probably damaging 1.00
R0044:Synrg UTSW 11 84009181 missense probably damaging 1.00
R0082:Synrg UTSW 11 83987910 splice site probably benign
R0227:Synrg UTSW 11 84009432 missense probably damaging 1.00
R0361:Synrg UTSW 11 84024337 splice site probably null
R0494:Synrg UTSW 11 84019543 missense probably benign
R0548:Synrg UTSW 11 83982188 splice site probably benign
R0744:Synrg UTSW 11 84024305 nonsense probably null
R1114:Synrg UTSW 11 84023436 splice site probably benign
R1240:Synrg UTSW 11 84023356 missense probably damaging 1.00
R1989:Synrg UTSW 11 84019955 critical splice donor site probably null
R2247:Synrg UTSW 11 84009376 missense probably damaging 1.00
R2263:Synrg UTSW 11 83977152 missense possibly damaging 0.79
R2420:Synrg UTSW 11 84009224 missense probably damaging 0.96
R2421:Synrg UTSW 11 84009224 missense probably damaging 0.96
R2937:Synrg UTSW 11 83994354 missense probably damaging 1.00
R3783:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3784:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3785:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3787:Synrg UTSW 11 84001920 missense probably damaging 0.99
R3925:Synrg UTSW 11 84040899 missense probably benign 0.03
R3945:Synrg UTSW 11 84023406 missense probably damaging 1.00
R3950:Synrg UTSW 11 83989815 missense probably damaging 1.00
R5165:Synrg UTSW 11 83990935 missense probably benign 0.02
R5216:Synrg UTSW 11 83982196 missense probably damaging 0.99
R5293:Synrg UTSW 11 83981499 missense probably damaging 1.00
R5575:Synrg UTSW 11 84009552 critical splice donor site probably null
R6079:Synrg UTSW 11 84024300 missense probably damaging 1.00
R6085:Synrg UTSW 11 84039661 missense possibly damaging 0.80
R6138:Synrg UTSW 11 84024300 missense probably damaging 1.00
R6259:Synrg UTSW 11 84008658 missense probably damaging 1.00
R6751:Synrg UTSW 11 83981425 missense probably damaging 1.00
R6795:Synrg UTSW 11 84019914 missense probably damaging 1.00
R6944:Synrg UTSW 11 84025086 missense probably damaging 1.00
R7092:Synrg UTSW 11 84008857 missense possibly damaging 0.95
R7109:Synrg UTSW 11 84039672 missense possibly damaging 0.82
R7291:Synrg UTSW 11 84009381 missense probably damaging 1.00
R7489:Synrg UTSW 11 83990825 missense probably benign 0.33
U15987:Synrg UTSW 11 84024300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTCAGATGCTGCTCCAC -3'
(R):5'- GAAGACAGCTACAGTGTACTGAC -3'

Sequencing Primer
(F):5'- GCTCCACATGTTAAATATGTTTGCGC -3'
(R):5'- CTTAAAGGGTTGGGGCAG -3'
Posted On2016-10-24