Incidental Mutation 'R5561:Fbf1'
ID 436615
Institutional Source Beutler Lab
Gene Symbol Fbf1
Ensembl Gene ENSMUSG00000020776
Gene Name Fas (TNFRSF6) binding factor 1
Synonyms 1110033G01Rik
MMRRC Submission 043118-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5561 (G1)
Quality Score 205
Status Not validated
Chromosome 11
Chromosomal Location 116142285-116168166 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116157820 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 105 (D105G)
Ref Sequence ENSEMBL: ENSMUSP00000102043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103031] [ENSMUST00000106435] [ENSMUST00000124828]
AlphaFold A2A870
Predicted Effect probably damaging
Transcript: ENSMUST00000103031
AA Change: D105G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099320
Gene: ENSMUSG00000020776
AA Change: D105G

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106435
AA Change: D105G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102043
Gene: ENSMUSG00000020776
AA Change: D105G

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124828
AA Change: D105G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114558
Gene: ENSMUSG00000020776
AA Change: D105G

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150703
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik C A 14: 95,882,371 A188E probably benign Het
A630095N17Rik T C 1: 75,220,537 probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrv1 A G 13: 81,476,564 L3762P probably damaging Het
Amn1 G A 6: 149,185,024 R4W probably damaging Het
Atxn1 G T 13: 45,566,871 T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 T259S probably benign Het
Bsn C G 9: 108,105,511 R3681P unknown Het
C8b T C 4: 104,784,448 Y194H possibly damaging Het
Ccdc110 T G 8: 45,940,609 S119R probably benign Het
Ceacam20 A T 7: 19,970,393 Q123L possibly damaging Het
Clip3 A G 7: 30,298,849 D240G possibly damaging Het
Col24a1 T C 3: 145,298,827 F22S probably benign Het
Dlg5 T A 14: 24,177,792 M354L probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dnase1l3 A G 14: 7,967,847 V282A probably damaging Het
Dnhd1 G A 7: 105,714,821 G4127S probably damaging Het
Eed G A 7: 89,967,793 R165W probably damaging Het
Ephb2 C T 4: 136,661,406 V627M probably damaging Het
Fancc T C 13: 63,317,387 E502G possibly damaging Het
Fer T A 17: 64,037,585 Y246* probably null Het
Fer1l6 A G 15: 58,660,825 K1792E probably damaging Het
Foxi2 A G 7: 135,411,647 D202G probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
H2-DMb2 G T 17: 34,145,471 probably null Het
Helq G T 5: 100,787,050 D491E probably benign Het
Hgsnat A G 8: 25,946,334 V564A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st5 T A 10: 36,833,429 V320D probably damaging Het
Ifit1bl1 A T 19: 34,593,797 L420* probably null Het
Ift80 T G 3: 68,967,863 N178T probably benign Het
Ing4 C T 6: 125,047,060 T89I possibly damaging Het
Lcp1 G A 14: 75,212,508 D386N probably benign Het
Mdc1 T A 17: 35,848,546 I606K probably benign Het
Mllt10 T A 2: 18,109,845 M120K probably damaging Het
Morc1 G T 16: 48,449,348 L89F probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nav3 C A 10: 109,716,552 D1810Y probably damaging Het
Obscn G A 11: 59,036,093 T5532M probably damaging Het
Olfr527 C T 7: 140,336,152 Q97* probably null Het
Olfr716 A G 7: 107,148,090 N258S probably benign Het
Opn3 C T 1: 175,665,587 R137H probably damaging Het
Palld G A 8: 61,516,585 A993V probably damaging Het
Ppp1r12c A T 7: 4,486,356 probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Rapgef2 A T 3: 79,088,643 probably null Het
Ring1 T C 17: 34,021,458 E382G possibly damaging Het
Rpl22l1 T A 3: 28,806,820 N61K probably benign Het
Rpp14 A G 14: 8,090,558 probably null Het
Rusc2 C T 4: 43,415,932 Q413* probably null Het
Slco3a1 A G 7: 74,318,499 I491T possibly damaging Het
Smtnl1 C T 2: 84,818,395 V172I probably benign Het
Spats2l T A 1: 57,900,621 probably null Het
Spire1 T A 18: 67,506,646 N266Y probably damaging Het
Stox2 T C 8: 47,193,006 H473R probably damaging Het
Syne2 C T 12: 76,094,458 R121* probably null Het
Synrg G A 11: 84,002,240 probably null Het
Tm9sf1 C T 14: 55,638,097 V397M probably damaging Het
Trabd T C 15: 89,081,984 M48T probably benign Het
Ttn T A 2: 76,707,233 I26457F possibly damaging Het
Uggt2 C T 14: 119,041,527 R856Q probably benign Het
Ugt1a5 T A 1: 88,166,317 M89K probably benign Het
Vmn2r53 A T 7: 12,601,420 S104R probably damaging Het
Zdhhc12 A T 2: 30,092,484 L53Q probably null Het
Other mutations in Fbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Fbf1 APN 11 116151081 missense probably benign 0.00
IGL01420:Fbf1 APN 11 116145996 missense probably benign 0.07
IGL01971:Fbf1 APN 11 116143382 unclassified probably benign
IGL01995:Fbf1 APN 11 116151020 missense probably null 0.00
IGL02639:Fbf1 APN 11 116152600 missense probably benign 0.14
IGL02884:Fbf1 APN 11 116146513 missense probably damaging 1.00
IGL03001:Fbf1 APN 11 116165886 start gained probably benign
IGL03309:Fbf1 APN 11 116147811 missense probably damaging 1.00
R0098:Fbf1 UTSW 11 116148119 critical splice donor site probably null
R0098:Fbf1 UTSW 11 116148119 critical splice donor site probably null
R0234:Fbf1 UTSW 11 116155034 missense probably damaging 1.00
R0234:Fbf1 UTSW 11 116155034 missense probably damaging 1.00
R0257:Fbf1 UTSW 11 116155091 missense probably benign 0.05
R0394:Fbf1 UTSW 11 116152462 unclassified probably benign
R0637:Fbf1 UTSW 11 116160054 unclassified probably benign
R1512:Fbf1 UTSW 11 116147927 missense probably damaging 1.00
R1679:Fbf1 UTSW 11 116151017 critical splice donor site probably null
R1726:Fbf1 UTSW 11 116145454 missense probably benign
R1909:Fbf1 UTSW 11 116145992 missense possibly damaging 0.79
R1970:Fbf1 UTSW 11 116151491 missense possibly damaging 0.93
R2507:Fbf1 UTSW 11 116155426 missense probably benign
R2847:Fbf1 UTSW 11 116157688 critical splice donor site probably null
R2849:Fbf1 UTSW 11 116157688 critical splice donor site probably null
R2867:Fbf1 UTSW 11 116161448 unclassified probably benign
R3161:Fbf1 UTSW 11 116148220 missense probably damaging 1.00
R3711:Fbf1 UTSW 11 116161473 missense possibly damaging 0.66
R3711:Fbf1 UTSW 11 116163353 missense probably damaging 1.00
R3752:Fbf1 UTSW 11 116147796 missense probably benign 0.21
R4293:Fbf1 UTSW 11 116148894 missense probably damaging 1.00
R4344:Fbf1 UTSW 11 116147742 missense probably benign
R4345:Fbf1 UTSW 11 116147742 missense probably benign
R4604:Fbf1 UTSW 11 116158922 missense possibly damaging 0.81
R4828:Fbf1 UTSW 11 116148951 missense probably benign 0.00
R4936:Fbf1 UTSW 11 116152552 missense probably benign 0.05
R6392:Fbf1 UTSW 11 116152949 critical splice acceptor site probably null
R6559:Fbf1 UTSW 11 116155446 missense probably benign 0.15
R6993:Fbf1 UTSW 11 116152784 missense probably benign
R7207:Fbf1 UTSW 11 116149474 missense probably benign 0.01
R7544:Fbf1 UTSW 11 116165833 missense probably benign 0.01
R7988:Fbf1 UTSW 11 116152768 missense probably benign 0.00
R8230:Fbf1 UTSW 11 116146739 missense probably benign
R8262:Fbf1 UTSW 11 116154019 missense probably benign 0.19
R8508:Fbf1 UTSW 11 116165881 start codon destroyed probably null 0.00
X0020:Fbf1 UTSW 11 116150793 missense possibly damaging 0.78
X0060:Fbf1 UTSW 11 116148856 nonsense probably null
X0062:Fbf1 UTSW 11 116149426 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACACAGAGTTTGATCCTCCATCC -3'
(R):5'- TAGCTCAGTCTGGGAGGTTC -3'

Sequencing Primer
(F):5'- TCCTGCCACGATGATAATGG -3'
(R):5'- AGGTTCTGTGTCCGAGATGAG -3'
Posted On 2016-10-24