Incidental Mutation 'R5561:Syne2'
ID 436616
Institutional Source Beutler Lab
Gene Symbol Syne2
Ensembl Gene ENSMUSG00000063450
Gene Name spectrin repeat containing, nuclear envelope 2
Synonyms Nesp2g, diminished cone electroretinogram, Cpfl8, dice, 6820443O06Rik, nesprin-2, syne-2, D12Ertd777e
MMRRC Submission 043118-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.313) question?
Stock # R5561 (G1)
Quality Score 152
Status Not validated
Chromosome 12
Chromosomal Location 75865092-76157702 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 76141232 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 121 (R121*)
Ref Sequence ENSEMBL: ENSMUSP00000116718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044217] [ENSMUST00000085280] [ENSMUST00000126903] [ENSMUST00000131480] [ENSMUST00000143031] [ENSMUST00000154509]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000044217
AA Change: R6114*
SMART Domains Protein: ENSMUSP00000047697
Gene: ENSMUSG00000063450
AA Change: R6114*

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
coiled coil region 844 869 N/A INTRINSIC
coiled coil region 936 969 N/A INTRINSIC
coiled coil region 1006 1032 N/A INTRINSIC
SPEC 1427 1525 4.96e0 SMART
SPEC 1528 1632 2.48e-1 SMART
coiled coil region 1660 1699 N/A INTRINSIC
SPEC 2034 2131 1.83e0 SMART
coiled coil region 2173 2194 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
coiled coil region 2316 2348 N/A INTRINSIC
SPEC 2720 2820 1.44e-5 SMART
coiled coil region 2905 2934 N/A INTRINSIC
coiled coil region 2962 2989 N/A INTRINSIC
coiled coil region 3108 3136 N/A INTRINSIC
low complexity region 3333 3350 N/A INTRINSIC
low complexity region 3514 3523 N/A INTRINSIC
low complexity region 3666 3676 N/A INTRINSIC
coiled coil region 3678 3708 N/A INTRINSIC
coiled coil region 3761 3788 N/A INTRINSIC
coiled coil region 3846 3903 N/A INTRINSIC
coiled coil region 4015 4067 N/A INTRINSIC
low complexity region 4102 4115 N/A INTRINSIC
coiled coil region 4483 4511 N/A INTRINSIC
low complexity region 4557 4569 N/A INTRINSIC
coiled coil region 4655 4688 N/A INTRINSIC
low complexity region 4749 4763 N/A INTRINSIC
SPEC 4827 4926 5.25e-1 SMART
SPEC 4933 5038 2.64e-4 SMART
SPEC 5048 5152 1.47e-2 SMART
SPEC 5159 5259 4.29e0 SMART
SPEC 5263 5371 4.47e0 SMART
low complexity region 5373 5393 N/A INTRINSIC
SPEC 5583 5681 5.7e-1 SMART
Blast:SPEC 5690 5793 2e-53 BLAST
SPEC 5800 5900 2.11e0 SMART
SPEC 5907 6005 6.91e-8 SMART
SPEC 6012 6119 4.45e-11 SMART
SPEC 6126 6228 6.39e-12 SMART
SPEC 6235 6335 7.75e-11 SMART
SPEC 6539 6642 5.53e-7 SMART
SPEC 6649 6753 5.12e-2 SMART
KASH 6817 6874 8.17e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000085280
AA Change: R1375*
SMART Domains Protein: ENSMUSP00000082383
Gene: ENSMUSG00000063450
AA Change: R1375*

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
SPEC 88 187 5.25e-1 SMART
SPEC 194 299 2.64e-4 SMART
SPEC 309 413 1.47e-2 SMART
SPEC 420 520 4.29e0 SMART
SPEC 524 632 4.47e0 SMART
low complexity region 634 654 N/A INTRINSIC
SPEC 844 942 5.7e-1 SMART
Blast:SPEC 951 1054 2e-53 BLAST
SPEC 1061 1161 2.11e0 SMART
SPEC 1168 1266 6.91e-8 SMART
SPEC 1273 1380 4.45e-11 SMART
SPEC 1387 1489 6.39e-12 SMART
SPEC 1496 1596 7.75e-11 SMART
SPEC 1823 1926 5.53e-7 SMART
SPEC 1933 2037 5.12e-2 SMART
KASH 2095 2152 8.17e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126903
SMART Domains Protein: ENSMUSP00000115053
Gene: ENSMUSG00000063450

DomainStartEndE-ValueType
Blast:SPEC 19 62 5e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131480
SMART Domains Protein: ENSMUSP00000114364
Gene: ENSMUSG00000063450

DomainStartEndE-ValueType
Blast:SPEC 1 63 3e-33 BLAST
SPEC 70 168 6.91e-8 SMART
SPEC 175 269 3.46e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000132161
AA Change: R111*
SMART Domains Protein: ENSMUSP00000122781
Gene: ENSMUSG00000063450
AA Change: R111*

DomainStartEndE-ValueType
SPEC 10 117 4.45e-11 SMART
SPEC 124 226 6.39e-12 SMART
SPEC 233 333 7.75e-11 SMART
SPEC 560 663 5.53e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000139204
AA Change: R889*
SMART Domains Protein: ENSMUSP00000118921
Gene: ENSMUSG00000063450
AA Change: R889*

DomainStartEndE-ValueType
SPEC 39 147 4.47e0 SMART
low complexity region 149 169 N/A INTRINSIC
SPEC 359 457 5.7e-1 SMART
Blast:SPEC 466 569 3e-53 BLAST
SPEC 576 676 2.11e0 SMART
SPEC 683 781 6.91e-8 SMART
SPEC 788 895 4.45e-11 SMART
SPEC 902 1004 6.39e-12 SMART
SPEC 1011 1111 7.75e-11 SMART
SPEC 1315 1418 5.53e-7 SMART
SPEC 1425 1529 5.12e-2 SMART
KASH 1587 1644 8.17e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000143031
AA Change: R6115*
SMART Domains Protein: ENSMUSP00000119120
Gene: ENSMUSG00000063450
AA Change: R6115*

DomainStartEndE-ValueType
CH 33 134 7.97e-19 SMART
low complexity region 151 175 N/A INTRINSIC
CH 185 283 1.34e-20 SMART
low complexity region 494 505 N/A INTRINSIC
coiled coil region 541 572 N/A INTRINSIC
coiled coil region 845 870 N/A INTRINSIC
coiled coil region 937 970 N/A INTRINSIC
coiled coil region 1007 1033 N/A INTRINSIC
SPEC 1428 1526 4.96e0 SMART
SPEC 1529 1633 2.48e-1 SMART
coiled coil region 1661 1700 N/A INTRINSIC
SPEC 2035 2132 1.83e0 SMART
coiled coil region 2174 2195 N/A INTRINSIC
low complexity region 2296 2308 N/A INTRINSIC
coiled coil region 2317 2349 N/A INTRINSIC
SPEC 2721 2821 1.44e-5 SMART
coiled coil region 2906 2935 N/A INTRINSIC
coiled coil region 2963 2990 N/A INTRINSIC
coiled coil region 3109 3137 N/A INTRINSIC
low complexity region 3334 3351 N/A INTRINSIC
low complexity region 3515 3524 N/A INTRINSIC
low complexity region 3667 3677 N/A INTRINSIC
coiled coil region 3679 3709 N/A INTRINSIC
coiled coil region 3762 3789 N/A INTRINSIC
coiled coil region 3847 3904 N/A INTRINSIC
coiled coil region 4016 4068 N/A INTRINSIC
low complexity region 4103 4116 N/A INTRINSIC
coiled coil region 4484 4512 N/A INTRINSIC
low complexity region 4558 4570 N/A INTRINSIC
coiled coil region 4656 4689 N/A INTRINSIC
low complexity region 4750 4764 N/A INTRINSIC
SPEC 4828 4927 5.25e-1 SMART
SPEC 4934 5039 2.64e-4 SMART
SPEC 5049 5153 1.47e-2 SMART
SPEC 5160 5260 4.29e0 SMART
SPEC 5264 5372 4.47e0 SMART
low complexity region 5374 5394 N/A INTRINSIC
SPEC 5584 5682 5.7e-1 SMART
Blast:SPEC 5691 5794 2e-53 BLAST
SPEC 5801 5901 2.11e0 SMART
SPEC 5908 6006 6.91e-8 SMART
SPEC 6013 6120 4.45e-11 SMART
SPEC 6127 6229 6.39e-12 SMART
SPEC 6236 6336 7.75e-11 SMART
SPEC 6540 6643 5.53e-7 SMART
SPEC 6650 6754 5.12e-2 SMART
KASH 6813 6870 8.17e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000154509
AA Change: R121*
SMART Domains Protein: ENSMUSP00000116718
Gene: ENSMUSG00000063450
AA Change: R121*

DomainStartEndE-ValueType
SPEC 19 125 3.13e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear outer membrane protein that binds cytoplasmic F-actin. This binding tethers the nucleus to the cytoskeleton and aids in the maintenance of the structural integrity of the nucleus. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygotes for one knock-out allele show normal myonuclear positioning of both synaptic and non-synaptic nuclei in skeletal muscle cells. Homozygotes for another knock-out allele exhibit a thickened epidermis and altered nuclear envelope architecture inprimary dermal fibroblasts and keratinocytes. Mice homozygous for a spontaneous mutation exhibit early retinal defects in photoreceptors, secondary Neurons, and muller glia. [provided by MGI curators]
Allele List at MGI

 All alleles(5) : Targeted, knock-out(2) Gene trapped(3)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik T C 1: 75,197,181 (GRCm39) probably benign Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adgrv1 A G 13: 81,624,683 (GRCm39) L3762P probably damaging Het
Amn1 G A 6: 149,086,522 (GRCm39) R4W probably damaging Het
Atxn1 G T 13: 45,720,347 (GRCm39) T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 (GRCm38) T259S probably benign Het
Bsn C G 9: 107,982,710 (GRCm39) R3681P unknown Het
C8b T C 4: 104,641,645 (GRCm39) Y194H possibly damaging Het
Ccdc110 T G 8: 46,393,646 (GRCm39) S119R probably benign Het
Ccdc202 C A 14: 96,119,807 (GRCm39) A188E probably benign Het
Ceacam20 A T 7: 19,704,318 (GRCm39) Q123L possibly damaging Het
Clip3 A G 7: 29,998,274 (GRCm39) D240G possibly damaging Het
Col24a1 T C 3: 145,004,588 (GRCm39) F22S probably benign Het
Dlg5 T A 14: 24,227,860 (GRCm39) M354L probably benign Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Dnase1l3 A G 14: 7,967,847 (GRCm38) V282A probably damaging Het
Dnhd1 G A 7: 105,364,028 (GRCm39) G4127S probably damaging Het
Eed G A 7: 89,617,001 (GRCm39) R165W probably damaging Het
Ephb2 C T 4: 136,388,717 (GRCm39) V627M probably damaging Het
Fancc T C 13: 63,465,201 (GRCm39) E502G possibly damaging Het
Fbf1 T C 11: 116,048,646 (GRCm39) D105G probably damaging Het
Fer T A 17: 64,344,580 (GRCm39) Y246* probably null Het
Fer1l6 A G 15: 58,532,674 (GRCm39) K1792E probably damaging Het
Foxi2 A G 7: 135,013,376 (GRCm39) D202G probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
H2-DMb2 G T 17: 34,364,445 (GRCm39) probably null Het
Helq G T 5: 100,934,916 (GRCm39) D491E probably benign Het
Hgsnat A G 8: 26,436,362 (GRCm39) V564A possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hs3st5 T A 10: 36,709,425 (GRCm39) V320D probably damaging Het
Ifit1bl1 A T 19: 34,571,197 (GRCm39) L420* probably null Het
Ift80 T G 3: 68,875,196 (GRCm39) N178T probably benign Het
Ing4 C T 6: 125,024,023 (GRCm39) T89I possibly damaging Het
Lcp1 G A 14: 75,449,948 (GRCm39) D386N probably benign Het
Mdc1 T A 17: 36,159,438 (GRCm39) I606K probably benign Het
Mllt10 T A 2: 18,114,656 (GRCm39) M120K probably damaging Het
Morc1 G T 16: 48,269,711 (GRCm39) L89F probably benign Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Nav3 C A 10: 109,552,413 (GRCm39) D1810Y probably damaging Het
Obscn G A 11: 58,926,919 (GRCm39) T5532M probably damaging Het
Opn3 C T 1: 175,493,153 (GRCm39) R137H probably damaging Het
Or12j2 C T 7: 139,916,065 (GRCm39) Q97* probably null Het
Or2d36 A G 7: 106,747,297 (GRCm39) N258S probably benign Het
Palld G A 8: 61,969,619 (GRCm39) A993V probably damaging Het
Ppp1r12c A T 7: 4,489,355 (GRCm39) probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,728,987 (GRCm39) probably null Het
Rapgef2 A T 3: 78,995,950 (GRCm39) probably null Het
Ring1 T C 17: 34,240,432 (GRCm39) E382G possibly damaging Het
Rpl22l1 T A 3: 28,860,969 (GRCm39) N61K probably benign Het
Rpp14 A G 14: 8,090,558 (GRCm38) probably null Het
Rusc2 C T 4: 43,415,932 (GRCm39) Q413* probably null Het
Slco3a1 A G 7: 73,968,247 (GRCm39) I491T possibly damaging Het
Smtnl1 C T 2: 84,648,739 (GRCm39) V172I probably benign Het
Spats2l T A 1: 57,939,780 (GRCm39) probably null Het
Spire1 T A 18: 67,639,716 (GRCm39) N266Y probably damaging Het
Stox2 T C 8: 47,646,041 (GRCm39) H473R probably damaging Het
Synrg G A 11: 83,893,066 (GRCm39) probably null Het
Tm9sf1 C T 14: 55,875,554 (GRCm39) V397M probably damaging Het
Trabd T C 15: 88,966,187 (GRCm39) M48T probably benign Het
Ttn T A 2: 76,537,577 (GRCm39) I26457F possibly damaging Het
Uggt2 C T 14: 119,278,939 (GRCm39) R856Q probably benign Het
Ugt1a5 T A 1: 88,094,039 (GRCm39) M89K probably benign Het
Vmn2r53 A T 7: 12,335,347 (GRCm39) S104R probably damaging Het
Zdhhc12 A T 2: 29,982,496 (GRCm39) L53Q probably null Het
Other mutations in Syne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Syne2 APN 12 76,078,474 (GRCm39) unclassified probably benign
IGL00595:Syne2 APN 12 75,972,420 (GRCm39) missense possibly damaging 0.76
IGL00672:Syne2 APN 12 76,110,958 (GRCm39) missense probably damaging 1.00
IGL00781:Syne2 APN 12 76,070,836 (GRCm39) missense probably benign 0.00
IGL00823:Syne2 APN 12 76,036,016 (GRCm39) missense probably damaging 0.98
IGL01014:Syne2 APN 12 75,952,051 (GRCm39) missense probably damaging 0.99
IGL01074:Syne2 APN 12 76,078,361 (GRCm39) nonsense probably null
IGL01074:Syne2 APN 12 76,033,785 (GRCm39) missense probably benign 0.00
IGL01324:Syne2 APN 12 76,090,526 (GRCm39) missense probably damaging 1.00
IGL01325:Syne2 APN 12 75,973,288 (GRCm39) missense probably benign 0.01
IGL01331:Syne2 APN 12 75,976,027 (GRCm39) splice site probably benign
IGL01338:Syne2 APN 12 76,107,000 (GRCm39) missense possibly damaging 0.55
IGL01373:Syne2 APN 12 76,033,881 (GRCm39) missense probably damaging 1.00
IGL01446:Syne2 APN 12 76,088,149 (GRCm39) missense probably damaging 1.00
IGL01556:Syne2 APN 12 76,134,589 (GRCm39) missense probably damaging 1.00
IGL01585:Syne2 APN 12 75,995,834 (GRCm39) critical splice acceptor site probably null
IGL01629:Syne2 APN 12 76,051,377 (GRCm39) missense possibly damaging 0.49
IGL01686:Syne2 APN 12 75,956,110 (GRCm39) missense probably benign
IGL01935:Syne2 APN 12 75,972,087 (GRCm39) missense probably damaging 1.00
IGL01941:Syne2 APN 12 76,013,994 (GRCm39) missense probably benign 0.01
IGL01956:Syne2 APN 12 76,144,748 (GRCm39) missense probably damaging 1.00
IGL01967:Syne2 APN 12 75,988,077 (GRCm39) missense probably damaging 1.00
IGL01990:Syne2 APN 12 76,101,707 (GRCm39) missense probably damaging 1.00
IGL02000:Syne2 APN 12 76,062,419 (GRCm39) missense probably damaging 0.99
IGL02063:Syne2 APN 12 76,098,874 (GRCm39) missense probably damaging 0.96
IGL02069:Syne2 APN 12 75,974,186 (GRCm39) missense probably benign 0.13
IGL02120:Syne2 APN 12 75,993,480 (GRCm39) missense probably damaging 1.00
IGL02222:Syne2 APN 12 75,999,617 (GRCm39) missense probably damaging 0.96
IGL02223:Syne2 APN 12 76,155,079 (GRCm39) missense probably benign 0.00
IGL02321:Syne2 APN 12 75,965,773 (GRCm39) missense possibly damaging 0.58
IGL02488:Syne2 APN 12 76,012,512 (GRCm39) missense probably benign 0.24
IGL02491:Syne2 APN 12 76,118,953 (GRCm39) missense probably benign 0.10
IGL02525:Syne2 APN 12 76,147,777 (GRCm39) missense probably damaging 0.99
IGL02578:Syne2 APN 12 76,069,053 (GRCm39) missense possibly damaging 0.76
IGL02615:Syne2 APN 12 76,143,768 (GRCm39) missense probably damaging 1.00
IGL02702:Syne2 APN 12 76,144,698 (GRCm39) missense probably damaging 1.00
IGL02726:Syne2 APN 12 76,062,356 (GRCm39) missense probably damaging 0.99
IGL02795:Syne2 APN 12 76,013,323 (GRCm39) missense probably damaging 0.99
IGL02803:Syne2 APN 12 76,078,320 (GRCm39) missense probably damaging 1.00
IGL02814:Syne2 APN 12 75,992,150 (GRCm39) missense possibly damaging 0.64
IGL03013:Syne2 APN 12 75,976,111 (GRCm39) missense probably benign 0.00
IGL03131:Syne2 APN 12 76,104,264 (GRCm39) missense probably damaging 1.00
IGL03152:Syne2 APN 12 76,012,486 (GRCm39) missense probably benign 0.12
IGL03216:Syne2 APN 12 75,989,735 (GRCm39) splice site probably benign
IGL03228:Syne2 APN 12 76,026,686 (GRCm39) missense probably benign 0.01
IGL03259:Syne2 APN 12 76,035,853 (GRCm39) missense probably benign 0.05
IGL03374:Syne2 APN 12 76,121,360 (GRCm39) missense possibly damaging 0.66
IGL03375:Syne2 APN 12 75,972,209 (GRCm39) missense possibly damaging 0.57
3-1:Syne2 UTSW 12 75,977,406 (GRCm39) missense probably benign 0.02
B5639:Syne2 UTSW 12 75,976,564 (GRCm39) missense probably benign
K3955:Syne2 UTSW 12 75,977,439 (GRCm39) missense probably damaging 1.00
P0026:Syne2 UTSW 12 75,926,994 (GRCm39) splice site probably benign
PIT4514001:Syne2 UTSW 12 76,151,789 (GRCm39) missense probably damaging 0.99
R0089:Syne2 UTSW 12 76,010,650 (GRCm39) missense probably damaging 1.00
R0110:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0113:Syne2 UTSW 12 76,080,496 (GRCm39) missense probably damaging 1.00
R0113:Syne2 UTSW 12 75,977,352 (GRCm39) missense probably damaging 1.00
R0141:Syne2 UTSW 12 75,988,072 (GRCm39) missense probably damaging 1.00
R0211:Syne2 UTSW 12 76,144,731 (GRCm39) missense probably damaging 1.00
R0219:Syne2 UTSW 12 76,088,778 (GRCm39) missense probably damaging 1.00
R0242:Syne2 UTSW 12 76,144,808 (GRCm39) missense probably damaging 1.00
R0242:Syne2 UTSW 12 76,144,808 (GRCm39) missense probably damaging 1.00
R0279:Syne2 UTSW 12 76,142,387 (GRCm39) missense probably damaging 1.00
R0319:Syne2 UTSW 12 76,110,936 (GRCm39) missense probably damaging 0.99
R0325:Syne2 UTSW 12 76,009,415 (GRCm39) missense probably benign 0.00
R0329:Syne2 UTSW 12 76,013,727 (GRCm39) missense probably benign
R0330:Syne2 UTSW 12 76,013,727 (GRCm39) missense probably benign
R0361:Syne2 UTSW 12 75,965,384 (GRCm39) missense probably benign 0.22
R0363:Syne2 UTSW 12 76,118,981 (GRCm39) missense probably damaging 0.98
R0367:Syne2 UTSW 12 75,926,951 (GRCm39) missense probably damaging 1.00
R0371:Syne2 UTSW 12 75,980,619 (GRCm39) missense probably damaging 1.00
R0374:Syne2 UTSW 12 75,968,000 (GRCm39) nonsense probably null
R0388:Syne2 UTSW 12 76,033,749 (GRCm39) missense probably benign 0.41
R0411:Syne2 UTSW 12 76,106,358 (GRCm39) splice site probably null
R0432:Syne2 UTSW 12 75,995,838 (GRCm39) missense probably damaging 0.99
R0469:Syne2 UTSW 12 75,900,923 (GRCm39) critical splice donor site probably null
R0492:Syne2 UTSW 12 76,028,837 (GRCm39) critical splice donor site probably null
R0496:Syne2 UTSW 12 76,085,714 (GRCm39) missense possibly damaging 0.80
R0504:Syne2 UTSW 12 76,080,365 (GRCm39) splice site probably benign
R0505:Syne2 UTSW 12 76,146,238 (GRCm39) missense probably damaging 1.00
R0510:Syne2 UTSW 12 75,900,923 (GRCm39) critical splice donor site probably null
R0518:Syne2 UTSW 12 76,155,636 (GRCm39) critical splice acceptor site probably null
R0539:Syne2 UTSW 12 76,070,895 (GRCm39) missense possibly damaging 0.69
R0552:Syne2 UTSW 12 75,977,778 (GRCm39) missense probably benign 0.00
R0557:Syne2 UTSW 12 75,976,075 (GRCm39) missense probably benign 0.04
R0567:Syne2 UTSW 12 75,937,004 (GRCm39) missense probably damaging 0.98
R0599:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0602:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0608:Syne2 UTSW 12 76,010,587 (GRCm39) missense probably damaging 1.00
R0614:Syne2 UTSW 12 75,959,127 (GRCm39) splice site probably null
R0636:Syne2 UTSW 12 75,977,757 (GRCm39) missense possibly damaging 0.75
R0647:Syne2 UTSW 12 75,934,977 (GRCm39) missense probably benign
R0654:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0658:Syne2 UTSW 12 76,141,110 (GRCm39) missense probably damaging 1.00
R0666:Syne2 UTSW 12 75,969,787 (GRCm39) missense probably damaging 0.99
R0707:Syne2 UTSW 12 76,028,837 (GRCm39) critical splice donor site probably null
R0714:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0841:Syne2 UTSW 12 76,121,209 (GRCm39) splice site probably benign
R0848:Syne2 UTSW 12 76,144,734 (GRCm39) nonsense probably null
R0848:Syne2 UTSW 12 76,144,733 (GRCm39) frame shift probably null
R1077:Syne2 UTSW 12 76,088,809 (GRCm39) missense possibly damaging 0.94
R1103:Syne2 UTSW 12 76,156,609 (GRCm39) missense probably benign 0.00
R1144:Syne2 UTSW 12 76,013,298 (GRCm39) missense probably benign 0.04
R1194:Syne2 UTSW 12 75,981,287 (GRCm39) missense probably damaging 1.00
R1247:Syne2 UTSW 12 76,014,264 (GRCm39) missense probably benign 0.39
R1276:Syne2 UTSW 12 75,987,963 (GRCm39) critical splice acceptor site probably null
R1343:Syne2 UTSW 12 76,080,417 (GRCm39) missense probably damaging 1.00
R1442:Syne2 UTSW 12 75,993,489 (GRCm39) missense probably damaging 1.00
R1448:Syne2 UTSW 12 76,098,952 (GRCm39) missense possibly damaging 0.56
R1448:Syne2 UTSW 12 76,067,099 (GRCm39) splice site probably null
R1522:Syne2 UTSW 12 76,150,557 (GRCm39) missense probably damaging 0.98
R1528:Syne2 UTSW 12 76,012,874 (GRCm39) missense probably benign 0.00
R1636:Syne2 UTSW 12 76,051,506 (GRCm39) missense probably benign 0.01
R1637:Syne2 UTSW 12 76,042,776 (GRCm39) missense probably damaging 1.00
R1650:Syne2 UTSW 12 75,951,033 (GRCm39) nonsense probably null
R1654:Syne2 UTSW 12 76,147,868 (GRCm39) missense possibly damaging 0.56
R1714:Syne2 UTSW 12 76,101,713 (GRCm39) missense probably benign 0.26
R1750:Syne2 UTSW 12 76,099,579 (GRCm39) missense probably damaging 1.00
R1772:Syne2 UTSW 12 75,985,503 (GRCm39) missense probably benign 0.19
R1797:Syne2 UTSW 12 76,010,557 (GRCm39) missense probably benign 0.00
R1830:Syne2 UTSW 12 76,156,636 (GRCm39) missense probably damaging 1.00
R1837:Syne2 UTSW 12 76,014,434 (GRCm39) missense probably damaging 0.99
R1908:Syne2 UTSW 12 76,141,053 (GRCm39) critical splice acceptor site probably null
R1913:Syne2 UTSW 12 75,946,020 (GRCm39) missense possibly damaging 0.60
R1944:Syne2 UTSW 12 76,121,318 (GRCm39) missense probably damaging 1.00
R1950:Syne2 UTSW 12 75,999,644 (GRCm39) missense probably benign
R1958:Syne2 UTSW 12 76,016,319 (GRCm39) missense probably benign 0.11
R2018:Syne2 UTSW 12 76,121,353 (GRCm39) missense probably damaging 1.00
R2037:Syne2 UTSW 12 76,072,343 (GRCm39) missense probably benign 0.04
R2067:Syne2 UTSW 12 75,935,116 (GRCm39) critical splice donor site probably null
R2073:Syne2 UTSW 12 76,062,353 (GRCm39) missense possibly damaging 0.54
R2099:Syne2 UTSW 12 76,026,747 (GRCm39) missense probably benign 0.06
R2102:Syne2 UTSW 12 76,074,853 (GRCm39) missense probably benign 0.01
R2134:Syne2 UTSW 12 75,999,560 (GRCm39) missense probably damaging 0.99
R2135:Syne2 UTSW 12 75,999,560 (GRCm39) missense probably damaging 0.99
R2157:Syne2 UTSW 12 76,141,230 (GRCm39) missense probably damaging 1.00
R2173:Syne2 UTSW 12 76,147,763 (GRCm39) splice site probably benign
R2248:Syne2 UTSW 12 76,143,678 (GRCm39) missense probably damaging 1.00
R2276:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2277:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2278:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2279:Syne2 UTSW 12 75,974,240 (GRCm39) missense possibly damaging 0.87
R2483:Syne2 UTSW 12 76,142,311 (GRCm39) missense probably damaging 1.00
R2877:Syne2 UTSW 12 76,047,605 (GRCm39) missense probably benign 0.00
R2884:Syne2 UTSW 12 76,010,533 (GRCm39) missense probably benign 0.00
R3119:Syne2 UTSW 12 75,956,058 (GRCm39) missense probably benign 0.01
R3499:Syne2 UTSW 12 76,101,752 (GRCm39) splice site probably null
R3827:Syne2 UTSW 12 76,033,805 (GRCm39) missense probably benign 0.02
R3847:Syne2 UTSW 12 76,095,396 (GRCm39) missense probably damaging 1.00
R3849:Syne2 UTSW 12 76,092,839 (GRCm39) nonsense probably null
R3850:Syne2 UTSW 12 76,095,396 (GRCm39) missense probably damaging 1.00
R3859:Syne2 UTSW 12 75,976,558 (GRCm39) missense possibly damaging 0.55
R3861:Syne2 UTSW 12 76,013,253 (GRCm39) missense probably damaging 0.98
R4078:Syne2 UTSW 12 76,082,398 (GRCm39) missense probably damaging 1.00
R4116:Syne2 UTSW 12 75,977,853 (GRCm39) missense probably damaging 1.00
R4326:Syne2 UTSW 12 75,999,516 (GRCm39) missense probably damaging 1.00
R4335:Syne2 UTSW 12 76,074,866 (GRCm39) missense probably damaging 1.00
R4410:Syne2 UTSW 12 76,141,167 (GRCm39) missense probably damaging 1.00
R4412:Syne2 UTSW 12 76,152,834 (GRCm39) missense probably benign 0.01
R4444:Syne2 UTSW 12 76,069,804 (GRCm39) missense probably damaging 1.00
R4595:Syne2 UTSW 12 76,013,845 (GRCm39) missense possibly damaging 0.88
R4604:Syne2 UTSW 12 76,014,484 (GRCm39) missense probably damaging 0.99
R4606:Syne2 UTSW 12 76,036,027 (GRCm39) missense probably damaging 1.00
R4651:Syne2 UTSW 12 76,036,013 (GRCm39) missense probably damaging 0.99
R4656:Syne2 UTSW 12 76,078,147 (GRCm39) missense probably damaging 1.00
R4675:Syne2 UTSW 12 75,996,075 (GRCm39) missense probably damaging 1.00
R4790:Syne2 UTSW 12 76,067,165 (GRCm39) missense probably benign 0.19
R4791:Syne2 UTSW 12 75,956,018 (GRCm39) missense possibly damaging 0.96
R4799:Syne2 UTSW 12 75,945,941 (GRCm39) missense probably benign 0.04
R4836:Syne2 UTSW 12 76,026,593 (GRCm39) missense probably damaging 1.00
R4880:Syne2 UTSW 12 76,026,593 (GRCm39) missense probably damaging 1.00
R4881:Syne2 UTSW 12 76,026,593 (GRCm39) missense probably damaging 1.00
R4899:Syne2 UTSW 12 75,900,875 (GRCm39) missense probably benign 0.03
R4934:Syne2 UTSW 12 75,946,046 (GRCm39) missense probably benign 0.14
R4981:Syne2 UTSW 12 75,987,993 (GRCm39) missense probably damaging 0.98
R4996:Syne2 UTSW 12 75,990,724 (GRCm39) missense possibly damaging 0.87
R5056:Syne2 UTSW 12 75,955,905 (GRCm39) unclassified probably benign
R5066:Syne2 UTSW 12 76,013,325 (GRCm39) missense probably benign 0.05
R5095:Syne2 UTSW 12 75,999,600 (GRCm39) missense probably damaging 0.99
R5151:Syne2 UTSW 12 76,090,484 (GRCm39) missense probably benign 0.06
R5193:Syne2 UTSW 12 76,141,194 (GRCm39) missense probably damaging 1.00
R5267:Syne2 UTSW 12 75,985,515 (GRCm39) missense possibly damaging 0.74
R5288:Syne2 UTSW 12 76,146,112 (GRCm39) missense possibly damaging 0.94
R5402:Syne2 UTSW 12 76,106,213 (GRCm39) missense probably damaging 0.98
R5434:Syne2 UTSW 12 76,018,649 (GRCm39) missense probably damaging 1.00
R5441:Syne2 UTSW 12 76,035,917 (GRCm39) missense possibly damaging 0.75
R5488:Syne2 UTSW 12 75,934,946 (GRCm39) missense probably benign 0.13
R5497:Syne2 UTSW 12 75,927,163 (GRCm39) missense probably benign 0.19
R5506:Syne2 UTSW 12 75,985,495 (GRCm39) missense probably benign 0.01
R5509:Syne2 UTSW 12 75,968,018 (GRCm39) missense probably damaging 1.00
R5518:Syne2 UTSW 12 75,991,944 (GRCm39) missense possibly damaging 0.88
R5581:Syne2 UTSW 12 75,991,859 (GRCm39) missense probably benign 0.01
R5625:Syne2 UTSW 12 76,141,886 (GRCm39) missense probably benign 0.06
R5642:Syne2 UTSW 12 75,965,306 (GRCm39) missense probably damaging 1.00
R5665:Syne2 UTSW 12 76,154,991 (GRCm39) critical splice donor site probably null
R5666:Syne2 UTSW 12 75,997,733 (GRCm39) missense probably benign 0.16
R5670:Syne2 UTSW 12 75,997,733 (GRCm39) missense probably benign 0.16
R5691:Syne2 UTSW 12 76,074,630 (GRCm39) frame shift probably null
R5696:Syne2 UTSW 12 76,040,919 (GRCm39) missense probably benign 0.00
R5720:Syne2 UTSW 12 76,014,441 (GRCm39) missense probably benign 0.03
R5739:Syne2 UTSW 12 76,044,239 (GRCm39) missense possibly damaging 0.53
R5840:Syne2 UTSW 12 75,927,065 (GRCm39) splice site probably null
R5846:Syne2 UTSW 12 76,074,898 (GRCm39) missense probably benign 0.01
R5850:Syne2 UTSW 12 76,144,749 (GRCm39) missense probably damaging 1.00
R5889:Syne2 UTSW 12 76,119,026 (GRCm39) nonsense probably null
R5912:Syne2 UTSW 12 75,955,721 (GRCm39) critical splice donor site probably null
R5931:Syne2 UTSW 12 76,055,639 (GRCm39) missense probably benign 0.37
R5985:Syne2 UTSW 12 76,012,933 (GRCm39) missense probably damaging 0.96
R5988:Syne2 UTSW 12 75,976,191 (GRCm39) critical splice donor site probably null
R5990:Syne2 UTSW 12 76,070,918 (GRCm39) missense probably benign 0.10
R6038:Syne2 UTSW 12 75,925,158 (GRCm39) nonsense probably null
R6038:Syne2 UTSW 12 75,925,158 (GRCm39) nonsense probably null
R6132:Syne2 UTSW 12 75,991,921 (GRCm39) missense probably benign 0.14
R6136:Syne2 UTSW 12 75,952,099 (GRCm39) missense probably benign 0.24
R6229:Syne2 UTSW 12 75,967,994 (GRCm39) missense probably benign 0.00
R6252:Syne2 UTSW 12 76,016,210 (GRCm39) missense probably benign 0.39
R6271:Syne2 UTSW 12 75,937,155 (GRCm39) missense probably damaging 1.00
R6320:Syne2 UTSW 12 76,108,424 (GRCm39) missense probably damaging 0.96
R6339:Syne2 UTSW 12 76,035,927 (GRCm39) missense probably benign 0.34
R6380:Syne2 UTSW 12 76,151,754 (GRCm39) missense probably damaging 0.98
R6394:Syne2 UTSW 12 76,037,269 (GRCm39) missense probably benign 0.09
R6419:Syne2 UTSW 12 76,143,740 (GRCm39) missense probably damaging 1.00
R6426:Syne2 UTSW 12 75,969,857 (GRCm39) missense probably null 0.97
R6434:Syne2 UTSW 12 76,088,230 (GRCm39) missense probably damaging 0.99
R6437:Syne2 UTSW 12 76,037,188 (GRCm39) missense possibly damaging 0.87
R6466:Syne2 UTSW 12 75,990,675 (GRCm39) missense probably damaging 0.97
R6501:Syne2 UTSW 12 76,074,621 (GRCm39) splice site probably null
R6552:Syne2 UTSW 12 75,937,015 (GRCm39) missense possibly damaging 0.89
R6744:Syne2 UTSW 12 76,121,221 (GRCm39) missense probably damaging 1.00
R6810:Syne2 UTSW 12 75,989,659 (GRCm39) missense probably benign 0.00
R6831:Syne2 UTSW 12 76,013,568 (GRCm39) missense probably benign 0.39
R6861:Syne2 UTSW 12 75,956,040 (GRCm39) missense probably damaging 1.00
R6875:Syne2 UTSW 12 76,082,404 (GRCm39) missense probably damaging 0.99
R6892:Syne2 UTSW 12 76,009,302 (GRCm39) missense probably damaging 0.98
R6899:Syne2 UTSW 12 76,142,503 (GRCm39) splice site probably null
R6906:Syne2 UTSW 12 76,042,760 (GRCm39) missense possibly damaging 0.93
R6909:Syne2 UTSW 12 76,110,969 (GRCm39) missense probably benign 0.04
R6925:Syne2 UTSW 12 75,900,906 (GRCm39) missense possibly damaging 0.58
R6949:Syne2 UTSW 12 76,012,771 (GRCm39) missense probably benign 0.00
R6952:Syne2 UTSW 12 75,974,205 (GRCm39) missense possibly damaging 0.76
R6996:Syne2 UTSW 12 76,074,786 (GRCm39) missense probably damaging 0.99
R7080:Syne2 UTSW 12 76,099,501 (GRCm39) missense probably benign 0.00
R7083:Syne2 UTSW 12 75,990,662 (GRCm39) missense probably damaging 1.00
R7090:Syne2 UTSW 12 75,989,125 (GRCm39) missense probably benign
R7144:Syne2 UTSW 12 76,052,152 (GRCm39) missense probably benign 0.03
R7154:Syne2 UTSW 12 76,106,231 (GRCm39) missense possibly damaging 0.63
R7177:Syne2 UTSW 12 76,018,654 (GRCm39) nonsense probably null
R7190:Syne2 UTSW 12 76,113,361 (GRCm39) missense probably benign 0.01
R7206:Syne2 UTSW 12 76,051,531 (GRCm39) missense probably benign 0.02
R7208:Syne2 UTSW 12 76,078,172 (GRCm39) splice site probably null
R7230:Syne2 UTSW 12 75,980,674 (GRCm39) missense probably benign 0.12
R7260:Syne2 UTSW 12 75,991,853 (GRCm39) missense probably damaging 1.00
R7272:Syne2 UTSW 12 76,095,417 (GRCm39) missense probably benign 0.00
R7296:Syne2 UTSW 12 76,149,810 (GRCm39) missense probably benign 0.00
R7322:Syne2 UTSW 12 76,030,798 (GRCm39) missense probably damaging 1.00
R7329:Syne2 UTSW 12 76,013,758 (GRCm39) missense probably benign 0.01
R7332:Syne2 UTSW 12 76,014,529 (GRCm39) critical splice donor site probably null
R7381:Syne2 UTSW 12 75,973,263 (GRCm39) missense probably benign 0.11
R7401:Syne2 UTSW 12 76,014,155 (GRCm39) missense probably damaging 0.98
R7403:Syne2 UTSW 12 75,962,020 (GRCm39) missense not run
R7429:Syne2 UTSW 12 76,087,184 (GRCm39) nonsense probably null
R7429:Syne2 UTSW 12 75,980,770 (GRCm39) missense probably damaging 1.00
R7430:Syne2 UTSW 12 76,087,184 (GRCm39) nonsense probably null
R7430:Syne2 UTSW 12 75,980,770 (GRCm39) missense probably damaging 1.00
R7438:Syne2 UTSW 12 76,062,337 (GRCm39) missense probably benign 0.04
R7447:Syne2 UTSW 12 76,074,853 (GRCm39) missense probably benign 0.01
R7466:Syne2 UTSW 12 76,092,960 (GRCm39) missense possibly damaging 0.92
R7493:Syne2 UTSW 12 76,012,654 (GRCm39) missense probably benign 0.00
R7502:Syne2 UTSW 12 76,141,100 (GRCm39) missense probably damaging 1.00
R7543:Syne2 UTSW 12 75,953,616 (GRCm39) missense possibly damaging 0.93
R7569:Syne2 UTSW 12 75,974,164 (GRCm39) missense probably benign 0.00
R7599:Syne2 UTSW 12 76,013,145 (GRCm39) missense probably benign 0.04
R7618:Syne2 UTSW 12 75,992,108 (GRCm39) missense probably benign 0.01
R7639:Syne2 UTSW 12 75,981,273 (GRCm39) missense probably damaging 1.00
R7698:Syne2 UTSW 12 75,995,838 (GRCm39) missense probably damaging 0.99
R7702:Syne2 UTSW 12 76,037,161 (GRCm39) missense probably benign 0.16
R7737:Syne2 UTSW 12 75,989,622 (GRCm39) missense probably damaging 1.00
R7742:Syne2 UTSW 12 76,106,209 (GRCm39) missense probably benign 0.02
R7753:Syne2 UTSW 12 76,085,697 (GRCm39) missense probably benign 0.43
R7755:Syne2 UTSW 12 76,044,181 (GRCm39) missense probably benign 0.19
R7757:Syne2 UTSW 12 76,108,553 (GRCm39) missense possibly damaging 0.87
R7790:Syne2 UTSW 12 75,975,877 (GRCm39) splice site probably null
R7808:Syne2 UTSW 12 76,030,501 (GRCm39) splice site probably null
R7809:Syne2 UTSW 12 76,014,230 (GRCm39) missense probably benign 0.00
R7811:Syne2 UTSW 12 76,030,501 (GRCm39) splice site probably null
R7834:Syne2 UTSW 12 76,014,021 (GRCm39) missense probably benign 0.00
R7853:Syne2 UTSW 12 76,078,278 (GRCm39) missense probably damaging 1.00
R7867:Syne2 UTSW 12 76,030,501 (GRCm39) splice site probably null
R7896:Syne2 UTSW 12 76,082,397 (GRCm39) missense probably damaging 0.99
R7903:Syne2 UTSW 12 76,110,958 (GRCm39) missense probably damaging 1.00
R7944:Syne2 UTSW 12 75,951,079 (GRCm39) missense probably damaging 0.98
R7945:Syne2 UTSW 12 75,951,079 (GRCm39) missense probably damaging 0.98
R7963:Syne2 UTSW 12 76,067,174 (GRCm39) missense probably benign 0.38
R7996:Syne2 UTSW 12 76,051,441 (GRCm39) missense probably damaging 1.00
R7998:Syne2 UTSW 12 76,134,632 (GRCm39) missense probably damaging 1.00
R8010:Syne2 UTSW 12 75,977,512 (GRCm39) missense probably benign 0.39
R8016:Syne2 UTSW 12 75,989,681 (GRCm39) missense probably benign 0.19
R8140:Syne2 UTSW 12 75,959,127 (GRCm39) missense possibly damaging 0.63
R8141:Syne2 UTSW 12 76,108,442 (GRCm39) missense possibly damaging 0.66
R8206:Syne2 UTSW 12 76,062,365 (GRCm39) missense probably benign 0.03
R8258:Syne2 UTSW 12 75,996,143 (GRCm39) missense possibly damaging 0.95
R8259:Syne2 UTSW 12 75,996,143 (GRCm39) missense possibly damaging 0.95
R8320:Syne2 UTSW 12 76,150,604 (GRCm39) missense probably damaging 0.99
R8464:Syne2 UTSW 12 76,012,546 (GRCm39) missense probably benign 0.39
R8465:Syne2 UTSW 12 75,900,898 (GRCm39) missense possibly damaging 0.92
R8486:Syne2 UTSW 12 76,088,881 (GRCm39) nonsense probably null
R8488:Syne2 UTSW 12 76,012,546 (GRCm39) missense probably benign 0.39
R8511:Syne2 UTSW 12 76,055,647 (GRCm39) missense probably benign 0.03
R8540:Syne2 UTSW 12 76,141,148 (GRCm39) missense probably damaging 1.00
R8711:Syne2 UTSW 12 76,104,258 (GRCm39) missense probably damaging 1.00
R8722:Syne2 UTSW 12 75,972,095 (GRCm39) missense probably benign 0.04
R8827:Syne2 UTSW 12 76,095,357 (GRCm39) missense probably benign 0.00
R8867:Syne2 UTSW 12 75,989,620 (GRCm39) missense probably damaging 1.00
R8878:Syne2 UTSW 12 75,952,067 (GRCm39) missense probably benign
R8924:Syne2 UTSW 12 75,943,444 (GRCm39) missense probably damaging 0.97
R8966:Syne2 UTSW 12 76,146,197 (GRCm39) missense probably damaging 1.00
R9007:Syne2 UTSW 12 76,146,224 (GRCm39) missense possibly damaging 0.82
R9019:Syne2 UTSW 12 75,999,618 (GRCm39) missense possibly damaging 0.93
R9057:Syne2 UTSW 12 75,937,167 (GRCm39) missense probably damaging 1.00
R9067:Syne2 UTSW 12 75,950,994 (GRCm39) missense probably damaging 1.00
R9081:Syne2 UTSW 12 76,016,290 (GRCm39) nonsense probably null
R9091:Syne2 UTSW 12 75,977,834 (GRCm39) missense probably damaging 1.00
R9123:Syne2 UTSW 12 76,040,838 (GRCm39) missense probably damaging 1.00
R9147:Syne2 UTSW 12 75,937,158 (GRCm39) missense probably damaging 1.00
R9148:Syne2 UTSW 12 75,937,158 (GRCm39) missense probably damaging 1.00
R9163:Syne2 UTSW 12 76,009,349 (GRCm39) missense possibly damaging 0.88
R9192:Syne2 UTSW 12 76,156,703 (GRCm39) missense probably damaging 1.00
R9248:Syne2 UTSW 12 76,154,230 (GRCm39) intron probably benign
R9270:Syne2 UTSW 12 75,977,834 (GRCm39) missense probably damaging 1.00
R9292:Syne2 UTSW 12 75,997,823 (GRCm39) missense probably benign
R9397:Syne2 UTSW 12 76,040,849 (GRCm39) missense possibly damaging 0.59
R9454:Syne2 UTSW 12 76,141,844 (GRCm39) nonsense probably null
R9454:Syne2 UTSW 12 76,067,275 (GRCm39) missense probably damaging 0.99
R9478:Syne2 UTSW 12 76,154,387 (GRCm39) missense probably damaging 0.96
R9492:Syne2 UTSW 12 75,995,839 (GRCm39) missense possibly damaging 0.77
R9573:Syne2 UTSW 12 75,927,134 (GRCm39) missense probably damaging 1.00
R9611:Syne2 UTSW 12 76,080,460 (GRCm39) missense probably benign 0.05
R9623:Syne2 UTSW 12 75,986,760 (GRCm39) missense probably benign 0.12
R9647:Syne2 UTSW 12 76,151,875 (GRCm39) missense possibly damaging 0.55
R9652:Syne2 UTSW 12 76,101,620 (GRCm39) missense probably benign 0.00
R9667:Syne2 UTSW 12 75,926,951 (GRCm39) missense probably damaging 1.00
R9701:Syne2 UTSW 12 76,037,197 (GRCm39) missense probably damaging 1.00
R9794:Syne2 UTSW 12 76,047,617 (GRCm39) missense probably benign 0.04
R9802:Syne2 UTSW 12 76,037,197 (GRCm39) missense probably damaging 1.00
X0019:Syne2 UTSW 12 76,020,061 (GRCm39) missense probably benign 0.41
X0026:Syne2 UTSW 12 76,147,790 (GRCm39) missense possibly damaging 0.78
X0061:Syne2 UTSW 12 75,974,285 (GRCm39) critical splice donor site probably null
X0066:Syne2 UTSW 12 76,143,701 (GRCm39) missense probably damaging 1.00
Z1176:Syne2 UTSW 12 76,087,157 (GRCm39) missense possibly damaging 0.48
Z1176:Syne2 UTSW 12 76,014,315 (GRCm39) missense probably benign 0.01
Z1177:Syne2 UTSW 12 76,020,197 (GRCm39) missense probably damaging 1.00
Z1177:Syne2 UTSW 12 76,144,748 (GRCm39) missense probably damaging 1.00
Z1177:Syne2 UTSW 12 76,110,912 (GRCm39) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TGCAGCGAGATATCGAACAAC -3'
(R):5'- GCACCTTGAAAATCCTGGATCC -3'

Sequencing Primer
(F):5'- TATCGAACAACACAGTGCAGG -3'
(R):5'- CCTCTTAAGGGCTGAGATGAC -3'
Posted On 2016-10-24