Incidental Mutation 'R5561:Fancc'
ID 436618
Institutional Source Beutler Lab
Gene Symbol Fancc
Ensembl Gene ENSMUSG00000021461
Gene Name Fanconi anemia, complementation group C
Synonyms Facc
MMRRC Submission 043118-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock # R5561 (G1)
Quality Score 214
Status Not validated
Chromosome 13
Chromosomal Location 63285043-63497278 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63317387 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 502 (E502G)
Ref Sequence ENSEMBL: ENSMUSP00000123817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073029] [ENSMUST00000099444] [ENSMUST00000161977] [ENSMUST00000163091] [ENSMUST00000220684]
AlphaFold P50652
Predicted Effect possibly damaging
Transcript: ENSMUST00000073029
AA Change: E502G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072788
Gene: ENSMUSG00000021461
AA Change: E502G

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 558 1.8e-305 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099444
AA Change: E405G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097043
Gene: ENSMUSG00000021461
AA Change: E405G

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 461 5.8e-243 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159056
Predicted Effect probably benign
Transcript: ENSMUST00000159152
SMART Domains Protein: ENSMUSP00000124560
Gene: ENSMUSG00000021458

DomainStartEndE-ValueType
Leuk-A4-hydro_C 1 113 4.63e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160336
Predicted Effect possibly damaging
Transcript: ENSMUST00000161977
AA Change: E502G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123817
Gene: ENSMUSG00000021461
AA Change: E502G

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 558 1.8e-305 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163091
AA Change: E502G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000124406
Gene: ENSMUSG00000021461
AA Change: E502G

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 517 4.8e-238 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220684
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are grossly normal, but chromosome aberrations and sensitivity to DNA crosslinkers are seen. Both sexes have fewer germ cell numbers and impaired fertility. Marrow progenitors show decrease in colony forming ability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik C A 14: 95,882,371 A188E probably benign Het
A630095N17Rik T C 1: 75,220,537 probably benign Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrv1 A G 13: 81,476,564 L3762P probably damaging Het
Amn1 G A 6: 149,185,024 R4W probably damaging Het
Atxn1 G T 13: 45,566,871 T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 T259S probably benign Het
Bsn C G 9: 108,105,511 R3681P unknown Het
C8b T C 4: 104,784,448 Y194H possibly damaging Het
Ccdc110 T G 8: 45,940,609 S119R probably benign Het
Ceacam20 A T 7: 19,970,393 Q123L possibly damaging Het
Clip3 A G 7: 30,298,849 D240G possibly damaging Het
Col24a1 T C 3: 145,298,827 F22S probably benign Het
Dlg5 T A 14: 24,177,792 M354L probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Dnase1l3 A G 14: 7,967,847 V282A probably damaging Het
Dnhd1 G A 7: 105,714,821 G4127S probably damaging Het
Eed G A 7: 89,967,793 R165W probably damaging Het
Ephb2 C T 4: 136,661,406 V627M probably damaging Het
Fbf1 T C 11: 116,157,820 D105G probably damaging Het
Fer T A 17: 64,037,585 Y246* probably null Het
Fer1l6 A G 15: 58,660,825 K1792E probably damaging Het
Foxi2 A G 7: 135,411,647 D202G probably damaging Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
H2-DMb2 G T 17: 34,145,471 probably null Het
Helq G T 5: 100,787,050 D491E probably benign Het
Hgsnat A G 8: 25,946,334 V564A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hs3st5 T A 10: 36,833,429 V320D probably damaging Het
Ifit1bl1 A T 19: 34,593,797 L420* probably null Het
Ift80 T G 3: 68,967,863 N178T probably benign Het
Ing4 C T 6: 125,047,060 T89I possibly damaging Het
Lcp1 G A 14: 75,212,508 D386N probably benign Het
Mdc1 T A 17: 35,848,546 I606K probably benign Het
Mllt10 T A 2: 18,109,845 M120K probably damaging Het
Morc1 G T 16: 48,449,348 L89F probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nav3 C A 10: 109,716,552 D1810Y probably damaging Het
Obscn G A 11: 59,036,093 T5532M probably damaging Het
Olfr527 C T 7: 140,336,152 Q97* probably null Het
Olfr716 A G 7: 107,148,090 N258S probably benign Het
Opn3 C T 1: 175,665,587 R137H probably damaging Het
Palld G A 8: 61,516,585 A993V probably damaging Het
Ppp1r12c A T 7: 4,486,356 probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,893,123 probably null Het
Rapgef2 A T 3: 79,088,643 probably null Het
Ring1 T C 17: 34,021,458 E382G possibly damaging Het
Rpl22l1 T A 3: 28,806,820 N61K probably benign Het
Rpp14 A G 14: 8,090,558 probably null Het
Rusc2 C T 4: 43,415,932 Q413* probably null Het
Slco3a1 A G 7: 74,318,499 I491T possibly damaging Het
Smtnl1 C T 2: 84,818,395 V172I probably benign Het
Spats2l T A 1: 57,900,621 probably null Het
Spire1 T A 18: 67,506,646 N266Y probably damaging Het
Stox2 T C 8: 47,193,006 H473R probably damaging Het
Syne2 C T 12: 76,094,458 R121* probably null Het
Synrg G A 11: 84,002,240 probably null Het
Tm9sf1 C T 14: 55,638,097 V397M probably damaging Het
Trabd T C 15: 89,081,984 M48T probably benign Het
Ttn T A 2: 76,707,233 I26457F possibly damaging Het
Uggt2 C T 14: 119,041,527 R856Q probably benign Het
Ugt1a5 T A 1: 88,166,317 M89K probably benign Het
Vmn2r53 A T 7: 12,601,420 S104R probably damaging Het
Zdhhc12 A T 2: 30,092,484 L53Q probably null Het
Other mutations in Fancc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Fancc APN 13 63400245 missense probably damaging 1.00
IGL00846:Fancc APN 13 63340456 missense possibly damaging 0.89
IGL01404:Fancc APN 13 63361638 missense probably damaging 1.00
IGL02592:Fancc APN 13 63360197 missense probably damaging 1.00
IGL02625:Fancc APN 13 63398151 missense probably damaging 0.99
canneloni UTSW 13 63331823 intron probably benign
macaroni UTSW 13 63321865 critical splice donor site probably null
R0362:Fancc UTSW 13 63398156 missense possibly damaging 0.86
R0554:Fancc UTSW 13 63317469 missense probably benign 0.32
R0626:Fancc UTSW 13 63317391 missense probably damaging 0.97
R0627:Fancc UTSW 13 63317478 missense probably damaging 0.99
R0726:Fancc UTSW 13 63323411 missense probably benign 0.01
R0734:Fancc UTSW 13 63331842 missense probably damaging 1.00
R1363:Fancc UTSW 13 63361598 missense probably damaging 1.00
R1587:Fancc UTSW 13 63340432 missense probably benign 0.32
R1922:Fancc UTSW 13 63330567 missense possibly damaging 0.89
R4585:Fancc UTSW 13 63347564 missense probably benign 0.14
R4586:Fancc UTSW 13 63347564 missense probably benign 0.14
R4608:Fancc UTSW 13 63331823 intron probably benign
R5159:Fancc UTSW 13 63321865 critical splice donor site probably null
R5401:Fancc UTSW 13 63402953 missense probably damaging 1.00
R5699:Fancc UTSW 13 63330632 splice site probably null
R6200:Fancc UTSW 13 63360248 missense probably damaging 1.00
R6448:Fancc UTSW 13 63340428 missense probably damaging 0.98
R7562:Fancc UTSW 13 63403053 splice site probably null
R7615:Fancc UTSW 13 63317558 critical splice acceptor site probably null
R7805:Fancc UTSW 13 63360242 missense possibly damaging 0.86
R7864:Fancc UTSW 13 63400259 nonsense probably null
R8080:Fancc UTSW 13 63403023 missense
R8966:Fancc UTSW 13 63347471 missense probably benign 0.32
R8989:Fancc UTSW 13 63400276 missense possibly damaging 0.93
R9464:Fancc UTSW 13 63402955 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GTGACATCCTTTCTGCAAGC -3'
(R):5'- TTGTATTCCCCAGGTGGAGC -3'

Sequencing Primer
(F):5'- TGTACAGCACAGGTGGGC -3'
(R):5'- GCTGAAGGTATTAATCAACCGTCTCC -3'
Posted On 2016-10-24