Incidental Mutation 'R5561:Fancc'
ID 436618
Institutional Source Beutler Lab
Gene Symbol Fancc
Ensembl Gene ENSMUSG00000021461
Gene Name Fanconi anemia, complementation group C
Synonyms Facc
MMRRC Submission 043118-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.910) question?
Stock # R5561 (G1)
Quality Score 214
Status Not validated
Chromosome 13
Chromosomal Location 63452519-63645126 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63465201 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 502 (E502G)
Ref Sequence ENSEMBL: ENSMUSP00000123817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073029] [ENSMUST00000099444] [ENSMUST00000161977] [ENSMUST00000163091] [ENSMUST00000220684]
AlphaFold P50652
Predicted Effect possibly damaging
Transcript: ENSMUST00000073029
AA Change: E502G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072788
Gene: ENSMUSG00000021461
AA Change: E502G

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 558 1.8e-305 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099444
AA Change: E405G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097043
Gene: ENSMUSG00000021461
AA Change: E405G

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 461 5.8e-243 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159056
Predicted Effect probably benign
Transcript: ENSMUST00000159152
SMART Domains Protein: ENSMUSP00000124560
Gene: ENSMUSG00000021458

DomainStartEndE-ValueType
Leuk-A4-hydro_C 1 113 4.63e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160166
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160336
Predicted Effect possibly damaging
Transcript: ENSMUST00000161977
AA Change: E502G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123817
Gene: ENSMUSG00000021461
AA Change: E502G

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 558 1.8e-305 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163091
AA Change: E502G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000124406
Gene: ENSMUSG00000021461
AA Change: E502G

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 517 4.8e-238 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220684
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are grossly normal, but chromosome aberrations and sensitivity to DNA crosslinkers are seen. Both sexes have fewer germ cell numbers and impaired fertility. Marrow progenitors show decrease in colony forming ability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik T C 1: 75,197,181 (GRCm39) probably benign Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adgrv1 A G 13: 81,624,683 (GRCm39) L3762P probably damaging Het
Amn1 G A 6: 149,086,522 (GRCm39) R4W probably damaging Het
Atxn1 G T 13: 45,720,347 (GRCm39) T516N possibly damaging Het
Atxn7 A T 14: 14,089,260 (GRCm38) T259S probably benign Het
Bsn C G 9: 107,982,710 (GRCm39) R3681P unknown Het
C8b T C 4: 104,641,645 (GRCm39) Y194H possibly damaging Het
Ccdc110 T G 8: 46,393,646 (GRCm39) S119R probably benign Het
Ccdc202 C A 14: 96,119,807 (GRCm39) A188E probably benign Het
Ceacam20 A T 7: 19,704,318 (GRCm39) Q123L possibly damaging Het
Clip3 A G 7: 29,998,274 (GRCm39) D240G possibly damaging Het
Col24a1 T C 3: 145,004,588 (GRCm39) F22S probably benign Het
Dlg5 T A 14: 24,227,860 (GRCm39) M354L probably benign Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Dnase1l3 A G 14: 7,967,847 (GRCm38) V282A probably damaging Het
Dnhd1 G A 7: 105,364,028 (GRCm39) G4127S probably damaging Het
Eed G A 7: 89,617,001 (GRCm39) R165W probably damaging Het
Ephb2 C T 4: 136,388,717 (GRCm39) V627M probably damaging Het
Fbf1 T C 11: 116,048,646 (GRCm39) D105G probably damaging Het
Fer T A 17: 64,344,580 (GRCm39) Y246* probably null Het
Fer1l6 A G 15: 58,532,674 (GRCm39) K1792E probably damaging Het
Foxi2 A G 7: 135,013,376 (GRCm39) D202G probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
H2-DMb2 G T 17: 34,364,445 (GRCm39) probably null Het
Helq G T 5: 100,934,916 (GRCm39) D491E probably benign Het
Hgsnat A G 8: 26,436,362 (GRCm39) V564A possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hs3st5 T A 10: 36,709,425 (GRCm39) V320D probably damaging Het
Ifit1bl1 A T 19: 34,571,197 (GRCm39) L420* probably null Het
Ift80 T G 3: 68,875,196 (GRCm39) N178T probably benign Het
Ing4 C T 6: 125,024,023 (GRCm39) T89I possibly damaging Het
Lcp1 G A 14: 75,449,948 (GRCm39) D386N probably benign Het
Mdc1 T A 17: 36,159,438 (GRCm39) I606K probably benign Het
Mllt10 T A 2: 18,114,656 (GRCm39) M120K probably damaging Het
Morc1 G T 16: 48,269,711 (GRCm39) L89F probably benign Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Nav3 C A 10: 109,552,413 (GRCm39) D1810Y probably damaging Het
Obscn G A 11: 58,926,919 (GRCm39) T5532M probably damaging Het
Opn3 C T 1: 175,493,153 (GRCm39) R137H probably damaging Het
Or12j2 C T 7: 139,916,065 (GRCm39) Q97* probably null Het
Or2d36 A G 7: 106,747,297 (GRCm39) N258S probably benign Het
Palld G A 8: 61,969,619 (GRCm39) A993V probably damaging Het
Ppp1r12c A T 7: 4,489,355 (GRCm39) probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,728,987 (GRCm39) probably null Het
Rapgef2 A T 3: 78,995,950 (GRCm39) probably null Het
Ring1 T C 17: 34,240,432 (GRCm39) E382G possibly damaging Het
Rpl22l1 T A 3: 28,860,969 (GRCm39) N61K probably benign Het
Rpp14 A G 14: 8,090,558 (GRCm38) probably null Het
Rusc2 C T 4: 43,415,932 (GRCm39) Q413* probably null Het
Slco3a1 A G 7: 73,968,247 (GRCm39) I491T possibly damaging Het
Smtnl1 C T 2: 84,648,739 (GRCm39) V172I probably benign Het
Spats2l T A 1: 57,939,780 (GRCm39) probably null Het
Spire1 T A 18: 67,639,716 (GRCm39) N266Y probably damaging Het
Stox2 T C 8: 47,646,041 (GRCm39) H473R probably damaging Het
Syne2 C T 12: 76,141,232 (GRCm39) R121* probably null Het
Synrg G A 11: 83,893,066 (GRCm39) probably null Het
Tm9sf1 C T 14: 55,875,554 (GRCm39) V397M probably damaging Het
Trabd T C 15: 88,966,187 (GRCm39) M48T probably benign Het
Ttn T A 2: 76,537,577 (GRCm39) I26457F possibly damaging Het
Uggt2 C T 14: 119,278,939 (GRCm39) R856Q probably benign Het
Ugt1a5 T A 1: 88,094,039 (GRCm39) M89K probably benign Het
Vmn2r53 A T 7: 12,335,347 (GRCm39) S104R probably damaging Het
Zdhhc12 A T 2: 29,982,496 (GRCm39) L53Q probably null Het
Other mutations in Fancc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Fancc APN 13 63,548,059 (GRCm39) missense probably damaging 1.00
IGL00846:Fancc APN 13 63,488,270 (GRCm39) missense possibly damaging 0.89
IGL01404:Fancc APN 13 63,509,452 (GRCm39) missense probably damaging 1.00
IGL02592:Fancc APN 13 63,508,011 (GRCm39) missense probably damaging 1.00
IGL02625:Fancc APN 13 63,545,965 (GRCm39) missense probably damaging 0.99
canneloni UTSW 13 63,479,637 (GRCm39) intron probably benign
macaroni UTSW 13 63,469,679 (GRCm39) critical splice donor site probably null
R0362:Fancc UTSW 13 63,545,970 (GRCm39) missense possibly damaging 0.86
R0554:Fancc UTSW 13 63,465,283 (GRCm39) missense probably benign 0.32
R0626:Fancc UTSW 13 63,465,205 (GRCm39) missense probably damaging 0.97
R0627:Fancc UTSW 13 63,465,292 (GRCm39) missense probably damaging 0.99
R0726:Fancc UTSW 13 63,471,225 (GRCm39) missense probably benign 0.01
R0734:Fancc UTSW 13 63,479,656 (GRCm39) missense probably damaging 1.00
R1363:Fancc UTSW 13 63,509,412 (GRCm39) missense probably damaging 1.00
R1587:Fancc UTSW 13 63,488,246 (GRCm39) missense probably benign 0.32
R1922:Fancc UTSW 13 63,478,381 (GRCm39) missense possibly damaging 0.89
R4585:Fancc UTSW 13 63,495,378 (GRCm39) missense probably benign 0.14
R4586:Fancc UTSW 13 63,495,378 (GRCm39) missense probably benign 0.14
R4608:Fancc UTSW 13 63,479,637 (GRCm39) intron probably benign
R5159:Fancc UTSW 13 63,469,679 (GRCm39) critical splice donor site probably null
R5401:Fancc UTSW 13 63,550,767 (GRCm39) missense probably damaging 1.00
R5699:Fancc UTSW 13 63,478,446 (GRCm39) splice site probably null
R6200:Fancc UTSW 13 63,508,062 (GRCm39) missense probably damaging 1.00
R6448:Fancc UTSW 13 63,488,242 (GRCm39) missense probably damaging 0.98
R7562:Fancc UTSW 13 63,550,867 (GRCm39) splice site probably null
R7615:Fancc UTSW 13 63,465,372 (GRCm39) critical splice acceptor site probably null
R7805:Fancc UTSW 13 63,508,056 (GRCm39) missense possibly damaging 0.86
R7864:Fancc UTSW 13 63,548,073 (GRCm39) nonsense probably null
R8080:Fancc UTSW 13 63,550,837 (GRCm39) missense
R8966:Fancc UTSW 13 63,495,285 (GRCm39) missense probably benign 0.32
R8989:Fancc UTSW 13 63,548,090 (GRCm39) missense possibly damaging 0.93
R9464:Fancc UTSW 13 63,550,769 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GTGACATCCTTTCTGCAAGC -3'
(R):5'- TTGTATTCCCCAGGTGGAGC -3'

Sequencing Primer
(F):5'- TGTACAGCACAGGTGGGC -3'
(R):5'- GCTGAAGGTATTAATCAACCGTCTCC -3'
Posted On 2016-10-24