Incidental Mutation 'R5561:Atxn7'
ID 436622
Institutional Source Beutler Lab
Gene Symbol Atxn7
Ensembl Gene ENSMUSG00000021738
Gene Name ataxin 7
Synonyms Sca7, A430107N12Rik, ataxin-7
MMRRC Submission 043118-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5561 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 8362461-8508323 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 14089260 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 259 (T259S)
Ref Sequence ENSEMBL: ENSMUSP00000153613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022257] [ENSMUST00000223714] [ENSMUST00000223880]
AlphaFold Q8R4I1
Predicted Effect probably benign
Transcript: ENSMUST00000022257
AA Change: T259S

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022257
Gene: ENSMUSG00000021738
AA Change: T259S

DomainStartEndE-ValueType
low complexity region 13 47 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
ZnF_C2H2 135 157 2.47e1 SMART
low complexity region 174 197 N/A INTRINSIC
low complexity region 202 218 N/A INTRINSIC
Pfam:SCA7 313 381 1.4e-30 PFAM
low complexity region 393 413 N/A INTRINSIC
low complexity region 470 484 N/A INTRINSIC
low complexity region 619 647 N/A INTRINSIC
low complexity region 675 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223714
AA Change: T259S

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000223880
AA Change: T259S

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224616
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the 'pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. This locus has been mapped to chromosome 3, and it has been determined that the diseased allele associated with spinocerebellar ataxia-7 contains 37-306 CAG repeats (near the N-terminus), compared to 4-35 in the normal allele. The encoded protein is a component of the SPT3/TAF9/GCN5 acetyltransferase (STAGA) and TBP-free TAF-containing (TFTC) chromatin remodeling complexes, and it thus plays a role in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Heterozygotes for a targeted mutation with an expanded polyglutamine tract exhibit impaired coordination, ataxia, reduced growth, kyphosis, eye defects, poor reproduction, and high mortality at around 4 months. Homozygotes die at 7-8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630095N17Rik T C 1: 75,197,181 (GRCm39) probably benign Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Adgrv1 A G 13: 81,624,683 (GRCm39) L3762P probably damaging Het
Amn1 G A 6: 149,086,522 (GRCm39) R4W probably damaging Het
Atxn1 G T 13: 45,720,347 (GRCm39) T516N possibly damaging Het
Bsn C G 9: 107,982,710 (GRCm39) R3681P unknown Het
C8b T C 4: 104,641,645 (GRCm39) Y194H possibly damaging Het
Ccdc110 T G 8: 46,393,646 (GRCm39) S119R probably benign Het
Ccdc202 C A 14: 96,119,807 (GRCm39) A188E probably benign Het
Ceacam20 A T 7: 19,704,318 (GRCm39) Q123L possibly damaging Het
Clip3 A G 7: 29,998,274 (GRCm39) D240G possibly damaging Het
Col24a1 T C 3: 145,004,588 (GRCm39) F22S probably benign Het
Dlg5 T A 14: 24,227,860 (GRCm39) M354L probably benign Het
Dnajb12 GC G 10: 59,728,574 (GRCm39) probably null Het
Dnase1l3 A G 14: 7,967,847 (GRCm38) V282A probably damaging Het
Dnhd1 G A 7: 105,364,028 (GRCm39) G4127S probably damaging Het
Eed G A 7: 89,617,001 (GRCm39) R165W probably damaging Het
Ephb2 C T 4: 136,388,717 (GRCm39) V627M probably damaging Het
Fancc T C 13: 63,465,201 (GRCm39) E502G possibly damaging Het
Fbf1 T C 11: 116,048,646 (GRCm39) D105G probably damaging Het
Fer T A 17: 64,344,580 (GRCm39) Y246* probably null Het
Fer1l6 A G 15: 58,532,674 (GRCm39) K1792E probably damaging Het
Foxi2 A G 7: 135,013,376 (GRCm39) D202G probably damaging Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
H2-DMb2 G T 17: 34,364,445 (GRCm39) probably null Het
Helq G T 5: 100,934,916 (GRCm39) D491E probably benign Het
Hgsnat A G 8: 26,436,362 (GRCm39) V564A possibly damaging Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hs3st5 T A 10: 36,709,425 (GRCm39) V320D probably damaging Het
Ifit1bl1 A T 19: 34,571,197 (GRCm39) L420* probably null Het
Ift80 T G 3: 68,875,196 (GRCm39) N178T probably benign Het
Ing4 C T 6: 125,024,023 (GRCm39) T89I possibly damaging Het
Lcp1 G A 14: 75,449,948 (GRCm39) D386N probably benign Het
Mdc1 T A 17: 36,159,438 (GRCm39) I606K probably benign Het
Mllt10 T A 2: 18,114,656 (GRCm39) M120K probably damaging Het
Morc1 G T 16: 48,269,711 (GRCm39) L89F probably benign Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Nav3 C A 10: 109,552,413 (GRCm39) D1810Y probably damaging Het
Obscn G A 11: 58,926,919 (GRCm39) T5532M probably damaging Het
Opn3 C T 1: 175,493,153 (GRCm39) R137H probably damaging Het
Or12j2 C T 7: 139,916,065 (GRCm39) Q97* probably null Het
Or2d36 A G 7: 106,747,297 (GRCm39) N258S probably benign Het
Palld G A 8: 61,969,619 (GRCm39) A993V probably damaging Het
Ppp1r12c A T 7: 4,489,355 (GRCm39) probably null Het
Prdm4 TCTCCTCCT TCTCCT 10: 85,728,987 (GRCm39) probably null Het
Rapgef2 A T 3: 78,995,950 (GRCm39) probably null Het
Ring1 T C 17: 34,240,432 (GRCm39) E382G possibly damaging Het
Rpl22l1 T A 3: 28,860,969 (GRCm39) N61K probably benign Het
Rpp14 A G 14: 8,090,558 (GRCm38) probably null Het
Rusc2 C T 4: 43,415,932 (GRCm39) Q413* probably null Het
Slco3a1 A G 7: 73,968,247 (GRCm39) I491T possibly damaging Het
Smtnl1 C T 2: 84,648,739 (GRCm39) V172I probably benign Het
Spats2l T A 1: 57,939,780 (GRCm39) probably null Het
Spire1 T A 18: 67,639,716 (GRCm39) N266Y probably damaging Het
Stox2 T C 8: 47,646,041 (GRCm39) H473R probably damaging Het
Syne2 C T 12: 76,141,232 (GRCm39) R121* probably null Het
Synrg G A 11: 83,893,066 (GRCm39) probably null Het
Tm9sf1 C T 14: 55,875,554 (GRCm39) V397M probably damaging Het
Trabd T C 15: 88,966,187 (GRCm39) M48T probably benign Het
Ttn T A 2: 76,537,577 (GRCm39) I26457F possibly damaging Het
Uggt2 C T 14: 119,278,939 (GRCm39) R856Q probably benign Het
Ugt1a5 T A 1: 88,094,039 (GRCm39) M89K probably benign Het
Vmn2r53 A T 7: 12,335,347 (GRCm39) S104R probably damaging Het
Zdhhc12 A T 2: 29,982,496 (GRCm39) L53Q probably null Het
Other mutations in Atxn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Atxn7 APN 14 14,096,324 (GRCm38) splice site probably benign
IGL00782:Atxn7 APN 14 14,096,218 (GRCm38) missense possibly damaging 0.78
IGL01405:Atxn7 APN 14 14,100,105 (GRCm38) missense probably benign 0.00
IGL02828:Atxn7 APN 14 14,090,056 (GRCm38) missense probably damaging 1.00
IGL03119:Atxn7 APN 14 14,100,734 (GRCm38) missense probably damaging 1.00
IGL03139:Atxn7 APN 14 14,052,994 (GRCm38) missense probably damaging 0.97
IGL03282:Atxn7 APN 14 14,100,564 (GRCm38) missense probably damaging 0.99
IGL03387:Atxn7 APN 14 14,087,273 (GRCm38) splice site probably benign
Estes_park UTSW 14 14,096,317 (GRCm38) critical splice donor site probably null
Lumpy UTSW 14 14,089,446 (GRCm38) nonsense probably null
Oestes_park UTSW 14 14,096,268 (GRCm38) nonsense probably null
R0034:Atxn7 UTSW 14 14,100,846 (GRCm38) missense probably damaging 0.96
R0408:Atxn7 UTSW 14 14,100,317 (GRCm38) missense probably damaging 1.00
R0853:Atxn7 UTSW 14 14,089,465 (GRCm38) splice site probably benign
R1169:Atxn7 UTSW 14 14,095,468 (GRCm38) missense possibly damaging 0.81
R1678:Atxn7 UTSW 14 14,096,239 (GRCm38) missense probably damaging 1.00
R1802:Atxn7 UTSW 14 14,089,419 (GRCm38) missense probably benign 0.25
R2078:Atxn7 UTSW 14 14,052,975 (GRCm38) missense probably damaging 0.99
R2275:Atxn7 UTSW 14 14,013,268 (GRCm38) missense possibly damaging 0.85
R2394:Atxn7 UTSW 14 14,100,237 (GRCm38) missense probably damaging 1.00
R4118:Atxn7 UTSW 14 14,100,308 (GRCm38) missense probably benign 0.00
R4230:Atxn7 UTSW 14 14,100,381 (GRCm38) missense probably benign 0.00
R4588:Atxn7 UTSW 14 14,096,268 (GRCm38) nonsense probably null
R4688:Atxn7 UTSW 14 14,089,288 (GRCm38) missense probably benign 0.00
R4935:Atxn7 UTSW 14 14,100,401 (GRCm38) missense probably benign
R5041:Atxn7 UTSW 14 14,096,317 (GRCm38) critical splice donor site probably null
R5185:Atxn7 UTSW 14 14,090,063 (GRCm38) missense probably benign 0.04
R5641:Atxn7 UTSW 14 14,013,638 (GRCm38) missense probably damaging 0.99
R6490:Atxn7 UTSW 14 14,089,446 (GRCm38) nonsense probably null
R6549:Atxn7 UTSW 14 14,013,087 (GRCm38) missense probably damaging 0.99
R6623:Atxn7 UTSW 14 14,099,972 (GRCm38) missense probably damaging 1.00
R6950:Atxn7 UTSW 14 14,095,511 (GRCm38) missense probably damaging 1.00
R7054:Atxn7 UTSW 14 14,100,878 (GRCm38) missense probably benign 0.08
R7402:Atxn7 UTSW 14 14,095,427 (GRCm38) missense probably damaging 0.98
R7762:Atxn7 UTSW 14 14,100,467 (GRCm38) missense probably damaging 1.00
R8432:Atxn7 UTSW 14 14,013,635 (GRCm38) missense probably benign 0.06
R8786:Atxn7 UTSW 14 14,103,316 (GRCm38) missense possibly damaging 0.78
R9238:Atxn7 UTSW 14 14,089,441 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTGGCTCGCTGTTAACTC -3'
(R):5'- TGAGAAAGAAGTGTGATGTTACCTG -3'

Sequencing Primer
(F):5'- GGCTCGCTGTTAACTCTGCTAG -3'
(R):5'- GAAGTGTGATGTTACCTGATAATCTC -3'
Posted On 2016-10-24