Mutagenetix > Incidental Mutation

Incidental Mutation 'R5561:Dlg5'

436623

Institutional Source

Beutler Lab

Gene Symbol

Dlg5

Ensembl Gene

ENSMUSG00000021782

Gene Name

discs large MAGUK scaffold protein 5

Synonyms

4933429D20Rik

MMRRC Submission

043118-MU

Accession Numbers

Genbank: NM_001163513; MGI: 1918478

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5561 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24133953-24245920 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 24177792 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 354 (M354L)

Ref Sequence

ENSEMBL: ENSMUSP00000087879 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042009] [ENSMUST00000073687] [ENSMUST00000090398]

AlphaFold

E9Q9R9

Predicted Effect

probably benign
Transcript: ENSMUST00000042009

SMART Domains

Protein: ENSMUSP00000044852
Gene: ENSMUSG00000021782

Domain	Start	End	E-Value	Type
coiled coil region	20	247	N/A	INTRINSIC
low complexity region	261	274	N/A	INTRINSIC
PDZ	279	356	2.02e-10	SMART
PDZ	364	447	9.5e-16	SMART
low complexity region	510	517	N/A	INTRINSIC
low complexity region	692	711	N/A	INTRINSIC
low complexity region	903	918	N/A	INTRINSIC
PDZ	1009	1080	2.1e-17	SMART
PDZ	1164	1236	2.97e-8	SMART
SH3	1250	1314	3.73e-7	SMART
low complexity region	1338	1358	N/A	INTRINSIC
GuKc	1375	1561	5.43e-53	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000073687
AA Change: M331L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000073367
Gene: ENSMUSG00000021782
AA Change: M331L

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	22	36	N/A	INTRINSIC
low complexity region	44	66	N/A	INTRINSIC
Pfam:Takusan	104	191	1.4e-27	PFAM
coiled coil region	308	578	N/A	INTRINSIC
low complexity region	592	605	N/A	INTRINSIC
PDZ	610	687	2.02e-10	SMART
PDZ	695	773	1.25e-15	SMART
low complexity region	836	843	N/A	INTRINSIC
low complexity region	1018	1037	N/A	INTRINSIC
low complexity region	1229	1244	N/A	INTRINSIC
PDZ	1335	1406	2.1e-17	SMART
PDZ	1490	1562	2.97e-8	SMART
SH3	1576	1640	3.73e-7	SMART
low complexity region	1664	1684	N/A	INTRINSIC
GuKc	1701	1887	5.43e-53	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000090398
AA Change: M354L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000087879
Gene: ENSMUSG00000021782
AA Change: M354L

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	22	36	N/A	INTRINSIC
low complexity region	44	66	N/A	INTRINSIC
low complexity region	109	123	N/A	INTRINSIC
Pfam:Takusan	128	213	6e-33	PFAM
coiled coil region	331	601	N/A	INTRINSIC
low complexity region	615	628	N/A	INTRINSIC
PDZ	633	710	2.02e-10	SMART
PDZ	718	796	1.25e-15	SMART
low complexity region	859	866	N/A	INTRINSIC
low complexity region	1041	1060	N/A	INTRINSIC
low complexity region	1252	1267	N/A	INTRINSIC
PDZ	1358	1429	2.1e-17	SMART
PDZ	1513	1585	2.97e-8	SMART
SH3	1599	1663	3.73e-7	SMART
low complexity region	1687	1707	N/A	INTRINSIC
GuKc	1724	1910	5.43e-53	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of discs large (DLG) homologs, a subset of the membrane-associated guanylate kinase (MAGUK) superfamily. The MAGUK proteins are composed of a catalytically inactive guanylate kinase domain, in addition to PDZ and SH3 domains, and are thought to function as scaffolding molecules at sites of cell-cell contact. The protein encoded by this gene localizes to the plasma membrane and cytoplasm, and interacts with components of adherens junctions and the cytoskeleton. It is proposed to function in the transmission of extracellular signals to the cytoskeleton and in the maintenance of epithelial cell structure. Alternative splice variants have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit growth retardation, hydroencephaly, abnormal brain morphology, abnormal neurogenesis, kidney cysts, ureter defects, and abnormal kidney morphology. [provided by MGI curators]

Allele List at MGI

All alleles(19) : Targeted, other(1) Gene trapped(18)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921530L21Rik	C	A	14: 95,882,371	A188E	probably benign	Het
A630095N17Rik	T	C	1: 75,220,537		probably benign	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adgrv1	A	G	13: 81,476,564	L3762P	probably damaging	Het
Amn1	G	A	6: 149,185,024	R4W	probably damaging	Het
Atxn1	G	T	13: 45,566,871	T516N	possibly damaging	Het
Atxn7	A	T	14: 14,089,260	T259S	probably benign	Het
Bsn	C	G	9: 108,105,511	R3681P	unknown	Het
C8b	T	C	4: 104,784,448	Y194H	possibly damaging	Het
Ccdc110	T	G	8: 45,940,609	S119R	probably benign	Het
Ceacam20	A	T	7: 19,970,393	Q123L	possibly damaging	Het
Clip3	A	G	7: 30,298,849	D240G	possibly damaging	Het
Col24a1	T	C	3: 145,298,827	F22S	probably benign	Het
Dnajb12	GC	G	10: 59,892,752		probably null	Het
Dnase1l3	A	G	14: 7,967,847	V282A	probably damaging	Het
Dnhd1	G	A	7: 105,714,821	G4127S	probably damaging	Het
Eed	G	A	7: 89,967,793	R165W	probably damaging	Het
Ephb2	C	T	4: 136,661,406	V627M	probably damaging	Het
Fancc	T	C	13: 63,317,387	E502G	possibly damaging	Het
Fbf1	T	C	11: 116,157,820	D105G	probably damaging	Het
Fer	T	A	17: 64,037,585	Y246*	probably null	Het
Fer1l6	A	G	15: 58,660,825	K1792E	probably damaging	Het
Foxi2	A	G	7: 135,411,647	D202G	probably damaging	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
H2-DMb2	G	T	17: 34,145,471		probably null	Het
Helq	G	T	5: 100,787,050	D491E	probably benign	Het
Hgsnat	A	G	8: 25,946,334	V564A	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hs3st5	T	A	10: 36,833,429	V320D	probably damaging	Het
Ifit1bl1	A	T	19: 34,593,797	L420*	probably null	Het
Ift80	T	G	3: 68,967,863	N178T	probably benign	Het
Ing4	C	T	6: 125,047,060	T89I	possibly damaging	Het
Lcp1	G	A	14: 75,212,508	D386N	probably benign	Het
Mdc1	T	A	17: 35,848,546	I606K	probably benign	Het
Mllt10	T	A	2: 18,109,845	M120K	probably damaging	Het
Morc1	G	T	16: 48,449,348	L89F	probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Nav3	C	A	10: 109,716,552	D1810Y	probably damaging	Het
Obscn	G	A	11: 59,036,093	T5532M	probably damaging	Het
Olfr527	C	T	7: 140,336,152	Q97*	probably null	Het
Olfr716	A	G	7: 107,148,090	N258S	probably benign	Het
Opn3	C	T	1: 175,665,587	R137H	probably damaging	Het
Palld	G	A	8: 61,516,585	A993V	probably damaging	Het
Ppp1r12c	A	T	7: 4,486,356		probably null	Het
Prdm4	TCTCCTCCT	TCTCCT	10: 85,893,123		probably null	Het
Rapgef2	A	T	3: 79,088,643		probably null	Het
Ring1	T	C	17: 34,021,458	E382G	possibly damaging	Het
Rpl22l1	T	A	3: 28,806,820	N61K	probably benign	Het
Rpp14	A	G	14: 8,090,558		probably null	Het
Rusc2	C	T	4: 43,415,932	Q413*	probably null	Het
Slco3a1	A	G	7: 74,318,499	I491T	possibly damaging	Het
Smtnl1	C	T	2: 84,818,395	V172I	probably benign	Het
Spats2l	T	A	1: 57,900,621		probably null	Het
Spire1	T	A	18: 67,506,646	N266Y	probably damaging	Het
Stox2	T	C	8: 47,193,006	H473R	probably damaging	Het
Syne2	C	T	12: 76,094,458	R121*	probably null	Het
Synrg	G	A	11: 84,002,240		probably null	Het
Tm9sf1	C	T	14: 55,638,097	V397M	probably damaging	Het
Trabd	T	C	15: 89,081,984	M48T	probably benign	Het
Ttn	T	A	2: 76,707,233	I26457F	possibly damaging	Het
Uggt2	C	T	14: 119,041,527	R856Q	probably benign	Het
Ugt1a5	T	A	1: 88,166,317	M89K	probably benign	Het
Vmn2r53	A	T	7: 12,601,420	S104R	probably damaging	Het
Zdhhc12	A	T	2: 30,092,484	L53Q	probably null	Het

Other mutations in Dlg5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Dlg5	APN	14	24191161	missense	probably damaging	0.99
IGL00164:Dlg5	APN	14	24158464	missense	possibly damaging	0.89
IGL00767:Dlg5	APN	14	24165285	missense	probably damaging	1.00
IGL01284:Dlg5	APN	14	24146197	missense	probably damaging	1.00
IGL01328:Dlg5	APN	14	24202351	missense	probably damaging	0.98
IGL01532:Dlg5	APN	14	24158592	missense	probably benign
IGL01621:Dlg5	APN	14	24148221	missense	probably damaging	1.00
IGL01649:Dlg5	APN	14	24138691	missense	probably damaging	1.00
IGL01733:Dlg5	APN	14	24170449	missense	probably damaging	1.00
IGL02048:Dlg5	APN	14	24172203	missense	possibly damaging	0.87
IGL02103:Dlg5	APN	14	24144346	missense	probably damaging	1.00
IGL02138:Dlg5	APN	14	24158351	missense	probably benign
IGL02146:Dlg5	APN	14	24202361	missense	probably damaging	0.99
IGL02392:Dlg5	APN	14	24150209	missense	probably damaging	1.00
IGL02427:Dlg5	APN	14	24166207	missense	probably damaging	1.00
IGL02643:Dlg5	APN	14	24191182	missense	probably damaging	1.00
IGL02649:Dlg5	APN	14	24146251	missense	probably damaging	0.96
IGL02933:Dlg5	APN	14	24158499	missense	probably benign	0.06
IGL02965:Dlg5	APN	14	24172023	missense	probably damaging	1.00
IGL02988:Dlg5	APN	14	24166255	missense	probably damaging	1.00
IGL03351:Dlg5	APN	14	24170454	missense	probably benign	0.03
legerdemain	UTSW	14	24164547	missense	probably damaging	1.00
R0123:Dlg5	UTSW	14	24147206	missense	probably benign
R0131:Dlg5	UTSW	14	24138649	missense	probably damaging	1.00
R0709:Dlg5	UTSW	14	24146255	missense	probably damaging	1.00
R0920:Dlg5	UTSW	14	24176397	missense	probably damaging	1.00
R0924:Dlg5	UTSW	14	24135577	missense	probably damaging	1.00
R0930:Dlg5	UTSW	14	24135577	missense	probably damaging	1.00
R0981:Dlg5	UTSW	14	24154631	missense	probably damaging	1.00
R1402:Dlg5	UTSW	14	24176608	missense	probably benign	0.06
R1402:Dlg5	UTSW	14	24176608	missense	probably benign	0.06
R1438:Dlg5	UTSW	14	24154605	missense	possibly damaging	0.94
R1449:Dlg5	UTSW	14	24135643	missense	possibly damaging	0.82
R1465:Dlg5	UTSW	14	24154696	splice site	probably null
R1465:Dlg5	UTSW	14	24154696	splice site	probably null
R1543:Dlg5	UTSW	14	24144448	missense	probably damaging	1.00
R1824:Dlg5	UTSW	14	24149444	missense	probably benign	0.28
R1899:Dlg5	UTSW	14	24148300	missense	probably damaging	1.00
R1920:Dlg5	UTSW	14	24176571	missense	probably damaging	1.00
R1921:Dlg5	UTSW	14	24176571	missense	probably damaging	1.00
R1951:Dlg5	UTSW	14	24156469	splice site	probably benign
R1968:Dlg5	UTSW	14	24164119	nonsense	probably null
R2049:Dlg5	UTSW	14	24154647	missense	probably damaging	1.00
R2070:Dlg5	UTSW	14	24136635	missense	probably damaging	1.00
R2117:Dlg5	UTSW	14	24177758	nonsense	probably null
R2139:Dlg5	UTSW	14	24170544	missense	probably damaging	1.00
R2153:Dlg5	UTSW	14	24137157	missense	probably damaging	1.00
R2283:Dlg5	UTSW	14	24158663	missense	probably benign	0.00
R2293:Dlg5	UTSW	14	24158112	missense	probably benign
R2356:Dlg5	UTSW	14	24170428	critical splice donor site	probably null
R2362:Dlg5	UTSW	14	24158687	missense	probably benign	0.04
R2513:Dlg5	UTSW	14	24164525	missense	probably damaging	1.00
R3084:Dlg5	UTSW	14	24166190	missense	probably damaging	1.00
R3086:Dlg5	UTSW	14	24166190	missense	probably damaging	1.00
R3750:Dlg5	UTSW	14	24165260	missense	probably damaging	1.00
R3780:Dlg5	UTSW	14	24190310	unclassified	probably benign
R3782:Dlg5	UTSW	14	24190310	unclassified	probably benign
R3828:Dlg5	UTSW	14	24146158	missense	probably damaging	0.99
R4079:Dlg5	UTSW	14	24148260	missense	possibly damaging	0.94
R4393:Dlg5	UTSW	14	24177989	critical splice acceptor site	probably null
R4615:Dlg5	UTSW	14	24158168	missense	probably damaging	1.00
R4664:Dlg5	UTSW	14	24137181	missense	possibly damaging	0.90
R4712:Dlg5	UTSW	14	24177983	missense	possibly damaging	0.94
R4796:Dlg5	UTSW	14	24144383	missense	probably damaging	1.00
R4801:Dlg5	UTSW	14	24154689	missense	probably damaging	1.00
R4802:Dlg5	UTSW	14	24154689	missense	probably damaging	1.00
R4946:Dlg5	UTSW	14	24154361	missense	probably damaging	0.99
R5022:Dlg5	UTSW	14	24136622	missense	probably damaging	1.00
R5023:Dlg5	UTSW	14	24136622	missense	probably damaging	1.00
R5057:Dlg5	UTSW	14	24136622	missense	probably damaging	1.00
R5234:Dlg5	UTSW	14	24192862	missense	probably damaging	0.98
R5567:Dlg5	UTSW	14	24192913	nonsense	probably null
R5570:Dlg5	UTSW	14	24192913	nonsense	probably null
R5640:Dlg5	UTSW	14	24170461	missense	probably damaging	1.00
R5646:Dlg5	UTSW	14	24158699	missense	probably damaging	1.00
R5711:Dlg5	UTSW	14	24150648	missense	probably damaging	1.00
R5810:Dlg5	UTSW	14	24146254	missense	probably damaging	0.99
R5900:Dlg5	UTSW	14	24149447	missense	probably damaging	1.00
R5964:Dlg5	UTSW	14	24164089	missense	probably benign
R6190:Dlg5	UTSW	14	24190438	missense	probably damaging	0.99
R6240:Dlg5	UTSW	14	24149528	splice site	probably null
R6276:Dlg5	UTSW	14	24164568	missense	probably damaging	1.00
R6339:Dlg5	UTSW	14	24158060	missense	probably damaging	1.00
R6508:Dlg5	UTSW	14	24138706	missense	probably benign	0.45
R6527:Dlg5	UTSW	14	24190448	missense	possibly damaging	0.73
R6593:Dlg5	UTSW	14	24150652	missense	probably benign	0.01
R6687:Dlg5	UTSW	14	24190373	missense	probably damaging	1.00
R6965:Dlg5	UTSW	14	24149430	missense	probably damaging	1.00
R7051:Dlg5	UTSW	14	24146195	missense	possibly damaging	0.93
R7075:Dlg5	UTSW	14	24177797	missense	possibly damaging	0.49
R7149:Dlg5	UTSW	14	24190424	missense	probably benign	0.00
R7182:Dlg5	UTSW	14	24244856	missense
R7203:Dlg5	UTSW	14	24138655	missense	probably damaging	1.00
R7216:Dlg5	UTSW	14	24136638	nonsense	probably null
R7359:Dlg5	UTSW	14	24164547	missense	probably damaging	1.00
R7466:Dlg5	UTSW	14	24245212	missense	probably damaging	1.00
R7485:Dlg5	UTSW	14	24148322	missense	probably benign
R7485:Dlg5	UTSW	14	24177839	missense	probably damaging	0.98
R7629:Dlg5	UTSW	14	24245212	missense	probably damaging	1.00
R7666:Dlg5	UTSW	14	24157799	missense	probably damaging	1.00
R7804:Dlg5	UTSW	14	24165320	missense	possibly damaging	0.46
R7861:Dlg5	UTSW	14	24245212	missense	probably damaging	1.00
R7862:Dlg5	UTSW	14	24245212	missense	probably damaging	1.00
R7864:Dlg5	UTSW	14	24245212	missense	probably damaging	1.00
R7874:Dlg5	UTSW	14	24135619	missense	probably damaging	1.00
R7913:Dlg5	UTSW	14	24137124	splice site	probably null
R7981:Dlg5	UTSW	14	24158145	missense	probably benign
R8147:Dlg5	UTSW	14	24158327	missense	probably benign	0.07
R8204:Dlg5	UTSW	14	24160252	missense	probably damaging	1.00
R8206:Dlg5	UTSW	14	24160268	missense	possibly damaging	0.62
R8287:Dlg5	UTSW	14	24164385	missense	probably benign	0.40
R8296:Dlg5	UTSW	14	24148260	missense	possibly damaging	0.94
R8317:Dlg5	UTSW	14	24191230	missense	probably damaging	0.98
R8327:Dlg5	UTSW	14	24146320	missense	probably damaging	0.99
R8352:Dlg5	UTSW	14	24191193	missense	probably damaging	1.00
R8353:Dlg5	UTSW	14	24158145	missense	probably benign
R8409:Dlg5	UTSW	14	24176478	missense	probably damaging	1.00
R8452:Dlg5	UTSW	14	24191193	missense	probably damaging	1.00
R8453:Dlg5	UTSW	14	24158145	missense	probably benign
R8540:Dlg5	UTSW	14	24158699	missense	probably damaging	1.00
R8701:Dlg5	UTSW	14	24176700	missense	probably benign	0.04
R8925:Dlg5	UTSW	14	24156479	missense
R8927:Dlg5	UTSW	14	24156479	missense
R9025:Dlg5	UTSW	14	24149478	missense	probably benign	0.00
R9102:Dlg5	UTSW	14	24149499	missense	probably damaging	1.00
R9138:Dlg5	UTSW	14	24245308	missense	probably damaging	0.98
R9165:Dlg5	UTSW	14	24146241	missense	probably damaging	1.00
R9250:Dlg5	UTSW	14	24190475	missense	probably benign	0.07
R9267:Dlg5	UTSW	14	24154677	missense	probably damaging	1.00
R9269:Dlg5	UTSW	14	24192813	missense	probably damaging	0.99
R9291:Dlg5	UTSW	14	24191161	missense	probably damaging	0.99
R9387:Dlg5	UTSW	14	24147100	missense	probably damaging	0.99
R9729:Dlg5	UTSW	14	24154613	missense	probably benign	0.00
RF005:Dlg5	UTSW	14	24158493	nonsense	probably null
YA93:Dlg5	UTSW	14	24155133	unclassified	probably benign
Z1088:Dlg5	UTSW	14	24158094	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGAGGTGTTTCTAAGAAGCCC -3'
(R):5'- TGCCCTTTGGTAAACGTGG -3'

Sequencing Primer
(F):5'- TGTTTCTAAGAAGCCCACAAAGG -3'
(R):5'- GCTGAAGCACAATGGCTCATCAG -3'

Posted On

2016-10-24